Incidental Mutation 'R5884:Zzz3'
ID 454557
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Name zinc finger, ZZ domain containing 3
Synonyms 3110065C23Rik, 6430567E01Rik
MMRRC Submission 044087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5884 (G1)
Quality Score 97
Status Validated
Chromosome 3
Chromosomal Location 152395473-152462826 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152450658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 684 (S684P)
Ref Sequence ENSEMBL: ENSMUSP00000101707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
AlphaFold Q6KAQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000089982
AA Change: S683P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: S683P

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106100
AA Change: S684P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: S684P

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106101
AA Change: S684P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: S684P

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106103
AA Change: S183P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068
AA Change: S183P

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197987
Predicted Effect possibly damaging
Transcript: ENSMUST00000200570
AA Change: S187P

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068
AA Change: S187P

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Meta Mutation Damage Score 0.7126 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dtx3l C G 16: 35,932,233 E668Q probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Emx2 T G 19: 59,464,029 D248E probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Matn4 A T 2: 164,404,608 probably benign Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Nek5 C T 8: 22,088,801 probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1164 A G 2: 88,093,796 Y47H probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Rad51ap2 GAAAAGGAAACTATTTAAAA GAAAA 12: 11,457,533 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slc34a2 A T 5: 53,069,380 Q615L possibly damaging Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R1706:Zzz3 UTSW 3 152449098 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
R9143:Zzz3 UTSW 3 152458271 missense probably benign 0.04
R9243:Zzz3 UTSW 3 152428283 missense probably damaging 1.00
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCTTAGCCTCCTACCTGGAAC -3'
(R):5'- TCAAGCTAGTGACACAAAAGTAAGC -3'

Sequencing Primer
(F):5'- GAACGGTTCCTACCTTGAGAATC -3'
(R):5'- AGCAGGGCTAATCAGTTTAAAAC -3'
Posted On 2017-02-10