Mutagenetix > Incidental Mutations

Incidental Mutation 'R5884:Slc34a2'

454562

Institutional Source

Beutler Lab

Gene Symbol

Slc34a2

Ensembl Gene

ENSMUSG00000029188

Gene Name

solute carrier family 34 (sodium phosphate), member 2

Synonyms

D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b

MMRRC Submission

044087-MU

Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5884 (G1)

Quality Score

139

Status

Validated

Chromosome

Chromosomal Location

53038081-53071664 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53069380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 615 (Q615L)

Ref Sequence

ENSEMBL: ENSMUSP00000092380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094787]

AlphaFold

Q9DBP0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094787
AA Change: Q615L

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: Q615L

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	252	2.3e-26	PFAM
Pfam:Na_Pi_cotrans	374	551	2.6e-17	PFAM
low complexity region	553	570	N/A	INTRINSIC
low complexity region	616	645	N/A	INTRINSIC
low complexity region	649	655	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147243

Meta Mutation Damage Score

0.1083

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 95.6%
20x: 82.8%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bmp5	T	C	9: 75,898,554	M446T	probably damaging	Het
Cacna1g	C	T	11: 94,437,867	A1052T	probably damaging	Het
Cand1	C	T	10: 119,213,765	A359T	possibly damaging	Het
Ccne2	A	T	4: 11,199,411	T271S	probably benign	Het
Cep112	A	G	11: 108,570,316	T546A	probably damaging	Het
Ces1g	A	G	8: 93,306,930	S455P	probably benign	Het
Dnah11	A	T	12: 118,177,534	C496S	probably benign	Het
Dtx3l	C	G	16: 35,932,233	E668Q	probably benign	Het
Dysf	T	A	6: 84,186,081	F1579I	probably damaging	Het
Emx2	T	G	19: 59,464,029	D248E	probably damaging	Het
Eri2	A	C	7: 119,772,329	*275E	probably null	Het
F5	G	A	1: 164,195,646	R1591H	probably benign	Het
Fabp3	A	G	4: 130,312,338	T41A	probably benign	Het
Fam89a	C	T	8: 124,751,769	R14H	probably damaging	Het
Gbe1	T	A	16: 70,528,875		probably null	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Golga3	A	G	5: 110,216,895	E1211G	probably damaging	Het
Gpa33	T	C	1: 166,152,760	S131P	probably damaging	Het
Hyal6	T	C	6: 24,743,369	Y355H	probably damaging	Het
Ide	A	T	19: 37,272,153		probably null	Het
Ighv5-21	A	T	12: 114,320,186		probably benign	Het
Iglc1	A	T	16: 19,061,991		probably benign	Het
Impa1	A	T	3: 10,316,224	N199K	probably damaging	Het
Irx5	A	C	8: 92,360,630	T397P	possibly damaging	Het
Kdelc1	T	C	1: 44,117,100	N109S	probably benign	Het
Lonp2	A	G	8: 86,641,626	Y356C	probably damaging	Het
Matn4	A	T	2: 164,404,608		probably benign	Het
Nav2	T	A	7: 49,597,169	Y2147*	probably null	Het
Nek5	C	T	8: 22,088,801		probably null	Het
Olfr1014	T	A	2: 85,777,055	I157K	probably damaging	Het
Olfr1164	A	G	2: 88,093,796	Y47H	probably damaging	Het
Olfr1348	C	A	7: 6,501,843	V128L	probably benign	Het
Omt2b	A	G	9: 78,328,557	M55V	probably benign	Het
Parp4	T	A	14: 56,614,750	H796Q	probably damaging	Het
Pex2	T	C	3: 5,561,299	E150G	probably benign	Het
Psmb2	T	A	4: 126,684,221	V64E	possibly damaging	Het
Psmd6	C	T	14: 14,116,526	R63H	probably damaging	Het
Ptprd	A	G	4: 75,982,690	Y1061H	probably damaging	Het
Rab23	A	G	1: 33,724,886		probably benign	Het
Rad51ap2	GAAAAGGAAACTATTTAAAA	GAAAA	12: 11,457,533		probably benign	Het
Reg1	C	T	6: 78,428,217	S141L	possibly damaging	Het
Rock1	A	T	18: 10,099,361	I680K	probably benign	Het
Sez6l2	A	G	7: 126,970,156		probably benign	Het
Slu7	A	G	11: 43,443,418	K424E	probably benign	Het
Tctn2	A	T	5: 124,603,832		noncoding transcript	Het
Tmem87a	T	A	2: 120,404,124		probably benign	Het
Trappc4	A	G	9: 44,404,088	F198L	probably damaging	Het
Usp33	C	T	3: 152,368,330	T271I	probably benign	Het
Vmn1r15	T	A	6: 57,259,008	I287K	probably damaging	Het
Vmn2r75	A	C	7: 86,165,370	I305R	probably benign	Het
Wdr26	T	C	1: 181,187,541		probably benign	Het
Zzz3	T	C	3: 152,450,658	S684P	probably damaging	Het

Other mutations in Slc34a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Slc34a2	APN	5	53065608	missense	probably benign	0.06
IGL00845:Slc34a2	APN	5	53058354	splice site	probably benign
IGL01024:Slc34a2	APN	5	53067630	missense	possibly damaging	0.61
IGL01300:Slc34a2	APN	5	53068127	critical splice acceptor site	probably null
IGL01680:Slc34a2	APN	5	53060876	missense	probably damaging	1.00
IGL02226:Slc34a2	APN	5	53067731	missense	probably benign	0.12
IGL02682:Slc34a2	APN	5	53059238	missense	possibly damaging	0.64
IGL03294:Slc34a2	APN	5	53063998	missense	probably benign	0.00
tucumcari	UTSW	5	53064009	missense	possibly damaging	0.68
D4216:Slc34a2	UTSW	5	53065497	missense	probably benign	0.01
R0094:Slc34a2	UTSW	5	53063968	missense	probably benign	0.28
R0227:Slc34a2	UTSW	5	53069626	missense	possibly damaging	0.51
R0524:Slc34a2	UTSW	5	53064873	nonsense	probably null
R0836:Slc34a2	UTSW	5	53067707	missense	probably benign
R1525:Slc34a2	UTSW	5	53069506	missense	probably benign	0.00
R1655:Slc34a2	UTSW	5	53069419	missense	probably benign	0.00
R1753:Slc34a2	UTSW	5	53061391	missense	probably benign	0.37
R1838:Slc34a2	UTSW	5	53058436	missense	probably benign
R2361:Slc34a2	UTSW	5	53068145	missense	probably benign	0.10
R2405:Slc34a2	UTSW	5	53058181	missense	probably benign	0.04
R3688:Slc34a2	UTSW	5	53064832	missense	probably benign	0.06
R4108:Slc34a2	UTSW	5	53064009	missense	possibly damaging	0.68
R4176:Slc34a2	UTSW	5	53067568	missense	probably damaging	1.00
R4380:Slc34a2	UTSW	5	53069286	missense	probably damaging	1.00
R4464:Slc34a2	UTSW	5	53069182	missense	probably damaging	0.99
R4780:Slc34a2	UTSW	5	53069451	missense	probably damaging	1.00
R4816:Slc34a2	UTSW	5	53069020	missense	probably damaging	1.00
R4934:Slc34a2	UTSW	5	53067600	missense	probably damaging	1.00
R5265:Slc34a2	UTSW	5	53061434	missense	probably damaging	0.96
R5309:Slc34a2	UTSW	5	53069488	missense	probably damaging	0.96
R5313:Slc34a2	UTSW	5	53069339	missense	probably damaging	0.96
R6084:Slc34a2	UTSW	5	53067647	missense	possibly damaging	0.91
R6310:Slc34a2	UTSW	5	53064797	critical splice acceptor site	probably null
R6568:Slc34a2	UTSW	5	53069134	missense	probably damaging	1.00
R6817:Slc34a2	UTSW	5	53064028	missense	probably damaging	0.98
R6845:Slc34a2	UTSW	5	53069169	missense	probably damaging	0.96
R6944:Slc34a2	UTSW	5	53064883	missense	probably benign
R7873:Slc34a2	UTSW	5	53058372	missense	probably benign	0.02
R8114:Slc34a2	UTSW	5	53068359	missense	probably benign	0.00
R8158:Slc34a2	UTSW	5	53060840	missense	probably damaging	1.00
R8364:Slc34a2	UTSW	5	53068374	missense	possibly damaging	0.75
R9158:Slc34a2	UTSW	5	53063875	missense	possibly damaging	0.95
R9235:Slc34a2	UTSW	5	53069325	missense	probably benign	0.00
R9314:Slc34a2	UTSW	5	53060801	missense	possibly damaging	0.61
Z1176:Slc34a2	UTSW	5	53060817	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACAGTGTTTGGCCTGTCTC -3'
(R):5'- AGAACTTCCACTTGGCCCTTG -3'

Sequencing Primer
(F):5'- CCTGTCTCTGGCAGGCTG -3'
(R):5'- GCCCTTGCCCTCATCTTGG -3'

Posted On

2017-02-10