Incidental Mutation 'R5884:Slc34a2'
ID 454562
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Name solute carrier family 34 (sodium phosphate), member 2
Synonyms D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b
MMRRC Submission 044087-MU
Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5884 (G1)
Quality Score 139
Status Validated
Chromosome 5
Chromosomal Location 53038081-53071664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53069380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 615 (Q615L)
Ref Sequence ENSEMBL: ENSMUSP00000092380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787]
AlphaFold Q9DBP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000094787
AA Change: Q615L

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: Q615L

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147243
Meta Mutation Damage Score 0.1083 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dtx3l C G 16: 35,932,233 E668Q probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Emx2 T G 19: 59,464,029 D248E probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Matn4 A T 2: 164,404,608 probably benign Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Nek5 C T 8: 22,088,801 probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1164 A G 2: 88,093,796 Y47H probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Rad51ap2 GAAAAGGAAACTATTTAAAA GAAAA 12: 11,457,533 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Zzz3 T C 3: 152,450,658 S684P probably damaging Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53065608 missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53058354 splice site probably benign
IGL01024:Slc34a2 APN 5 53067630 missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53068127 critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53060876 missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53067731 missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53059238 missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53063998 missense probably benign 0.00
tucumcari UTSW 5 53064009 missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53065497 missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53063968 missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53069626 missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53064873 nonsense probably null
R0836:Slc34a2 UTSW 5 53067707 missense probably benign
R1525:Slc34a2 UTSW 5 53069506 missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53069419 missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53061391 missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53058436 missense probably benign
R2361:Slc34a2 UTSW 5 53068145 missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53058181 missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53064832 missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53064009 missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53067568 missense probably damaging 1.00
R4380:Slc34a2 UTSW 5 53069286 missense probably damaging 1.00
R4464:Slc34a2 UTSW 5 53069182 missense probably damaging 0.99
R4780:Slc34a2 UTSW 5 53069451 missense probably damaging 1.00
R4816:Slc34a2 UTSW 5 53069020 missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53067600 missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53061434 missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53069488 missense probably damaging 0.96
R5313:Slc34a2 UTSW 5 53069339 missense probably damaging 0.96
R6084:Slc34a2 UTSW 5 53067647 missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53064797 critical splice acceptor site probably null
R6568:Slc34a2 UTSW 5 53069134 missense probably damaging 1.00
R6817:Slc34a2 UTSW 5 53064028 missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53069169 missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53064883 missense probably benign
R7873:Slc34a2 UTSW 5 53058372 missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53068359 missense probably benign 0.00
R8158:Slc34a2 UTSW 5 53060840 missense probably damaging 1.00
R8364:Slc34a2 UTSW 5 53068374 missense possibly damaging 0.75
R9158:Slc34a2 UTSW 5 53063875 missense possibly damaging 0.95
R9235:Slc34a2 UTSW 5 53069325 missense probably benign 0.00
R9314:Slc34a2 UTSW 5 53060801 missense possibly damaging 0.61
Z1176:Slc34a2 UTSW 5 53060817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACAGTGTTTGGCCTGTCTC -3'
(R):5'- AGAACTTCCACTTGGCCCTTG -3'

Sequencing Primer
(F):5'- CCTGTCTCTGGCAGGCTG -3'
(R):5'- GCCCTTGCCCTCATCTTGG -3'
Posted On 2017-02-10