Incidental Mutation 'R5884:Nek5'
ID454575
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
MMRRC Submission 044087-MU
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5884 (G1)
Quality Score207
Status Validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 22088801 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000169834] [ENSMUST00000209656] [ENSMUST00000209656]
Predicted Effect probably null
Transcript: ENSMUST00000169834
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000169834
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000209656
Predicted Effect probably null
Transcript: ENSMUST00000209656
Predicted Effect probably benign
Transcript: ENSMUST00000210824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213644
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dtx3l C G 16: 35,932,233 E668Q probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Emx2 T G 19: 59,464,029 D248E probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Matn4 A T 2: 164,404,608 probably benign Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1164 A G 2: 88,093,796 Y47H probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Rad51ap2 GAAAAGGAAACTATTTAAAA GAAAA 12: 11,457,533 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slc34a2 A T 5: 53,069,380 Q615L possibly damaging Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Zzz3 T C 3: 152,450,658 S684P probably damaging Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8350:Nek5 UTSW 8 22113672 missense probably damaging 0.98
R8847:Nek5 UTSW 8 22123579 missense probably benign 0.01
R8888:Nek5 UTSW 8 22090479 critical splice donor site probably null
R8933:Nek5 UTSW 8 22111210 missense probably damaging 1.00
R8933:Nek5 UTSW 8 22120843 missense probably damaging 1.00
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCATGAGTGAGTAGGACTCC -3'
(R):5'- GCACAAAGCTAATGCATTTAACTCC -3'

Sequencing Primer
(F):5'- CTGAGTAACTGCTAGATCCTTGGAC -3'
(R):5'- TGCATTTAACTCCCAATATGGC -3'
Posted On2017-02-10