Incidental Mutation 'R0555:Prickle2'
ID45458
Institutional Source Beutler Lab
Gene Symbol Prickle2
Ensembl Gene ENSMUSG00000030020
Gene Nameprickle planar cell polarity protein 2
Synonyms6230400G14Rik, mpk2, 6720451F06Rik
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R0555 (G1)
Quality Score192
Status Validated
Chromosome6
Chromosomal Location92370908-92706155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92458565 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 74 (F74L)
Ref Sequence ENSEMBL: ENSMUSP00000032093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]
Predicted Effect probably benign
Transcript: ENSMUST00000032093
AA Change: F74L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: F74L

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:PET 76 176 1.2e-45 PFAM
LIM 185 242 3.05e-10 SMART
LIM 250 302 5.43e-16 SMART
LIM 310 365 2.92e-7 SMART
low complexity region 465 477 N/A INTRINSIC
low complexity region 534 546 N/A INTRINSIC
low complexity region 725 753 N/A INTRINSIC
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113445
AA Change: F18L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: F18L

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113446
AA Change: F18L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: F18L

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113447
AA Change: F18L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: F18L

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Meta Mutation Damage Score 0.0965 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Prickle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02962:Prickle2 APN 6 92376422 missense probably benign 0.00
R0028:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R0122:Prickle2 UTSW 6 92411345 nonsense probably null
R0940:Prickle2 UTSW 6 92411003 missense probably benign 0.02
R1394:Prickle2 UTSW 6 92376382 missense possibly damaging 0.87
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1599:Prickle2 UTSW 6 92410874 missense probably benign
R1745:Prickle2 UTSW 6 92376593 missense probably damaging 1.00
R1801:Prickle2 UTSW 6 92416904 missense probably damaging 0.98
R1985:Prickle2 UTSW 6 92411452 missense probably damaging 1.00
R2085:Prickle2 UTSW 6 92376364 missense probably damaging 0.96
R2147:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2148:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2571:Prickle2 UTSW 6 92705400 missense probably benign 0.09
R3547:Prickle2 UTSW 6 92411137 missense probably damaging 1.00
R4356:Prickle2 UTSW 6 92411509 missense probably damaging 1.00
R4569:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R4896:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5004:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5045:Prickle2 UTSW 6 92376394 missense probably damaging 0.96
R5219:Prickle2 UTSW 6 92376530 missense probably benign
R5247:Prickle2 UTSW 6 92375969 missense probably damaging 1.00
R5280:Prickle2 UTSW 6 92376210 missense probably damaging 1.00
R5334:Prickle2 UTSW 6 92425684 missense probably damaging 1.00
R5780:Prickle2 UTSW 6 92458612 missense probably benign 0.06
R5960:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R6084:Prickle2 UTSW 6 92416848 nonsense probably null
R6362:Prickle2 UTSW 6 92458615 missense possibly damaging 0.77
R6368:Prickle2 UTSW 6 92420237 missense probably damaging 1.00
R6852:Prickle2 UTSW 6 92376544 missense probably benign
R7041:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R7203:Prickle2 UTSW 6 92410978 missense possibly damaging 0.61
R7352:Prickle2 UTSW 6 92410890 missense probably benign 0.00
R7405:Prickle2 UTSW 6 92458543 missense probably damaging 0.96
R7510:Prickle2 UTSW 6 92376470 missense possibly damaging 0.58
R7562:Prickle2 UTSW 6 92375948 makesense probably null
R7578:Prickle2 UTSW 6 92411290 missense probably benign 0.32
R7614:Prickle2 UTSW 6 92425650 missense possibly damaging 0.46
R7732:Prickle2 UTSW 6 92411224 missense probably damaging 1.00
R7948:Prickle2 UTSW 6 92416922 missense not run
X0020:Prickle2 UTSW 6 92416853 missense probably damaging 0.98
X0026:Prickle2 UTSW 6 92411426 nonsense probably null
X0066:Prickle2 UTSW 6 92376433 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGAGCCACCTTTCCCTTCTAAG -3'
(R):5'- GTTAGCACACTCACCTGGTAGTTCC -3'

Sequencing Primer
(F):5'- CCTTCTAAGCTGGGGTATGGAAAC -3'
(R):5'- AGGAGCACATGGTAACAGTG -3'
Posted On2013-06-11