Incidental Mutation 'R5884:Rad51ap2'
ID 454586
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 044087-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5884 (G1)
Quality Score 217
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation small deletion (5 aa in frame mutation)
DNA Base Change (assembly) GAAAAGGAAACTATTTAAAA to GAAAA at 11507534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably benign
Transcript: ENSMUST00000124065
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,805,836 (GRCm39) M446T probably damaging Het
Cacna1g C T 11: 94,328,693 (GRCm39) A1052T probably damaging Het
Cand1 C T 10: 119,049,670 (GRCm39) A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 (GRCm39) T271S probably benign Het
Cep112 A G 11: 108,461,142 (GRCm39) T546A probably damaging Het
Ces1g A G 8: 94,033,558 (GRCm39) S455P probably benign Het
Dnah11 A T 12: 118,141,269 (GRCm39) C496S probably benign Het
Dtx3l C G 16: 35,752,603 (GRCm39) E668Q probably benign Het
Dysf T A 6: 84,163,063 (GRCm39) F1579I probably damaging Het
Emx2 T G 19: 59,452,461 (GRCm39) D248E probably damaging Het
Eri2 A C 7: 119,371,552 (GRCm39) *275E probably null Het
F5 G A 1: 164,023,215 (GRCm39) R1591H probably benign Het
Fabp3 A G 4: 130,206,131 (GRCm39) T41A probably benign Het
Fam89a C T 8: 125,478,508 (GRCm39) R14H probably damaging Het
Gbe1 T A 16: 70,325,763 (GRCm39) probably null Het
Golga3 A G 5: 110,364,761 (GRCm39) E1211G probably damaging Het
Gpa33 T C 1: 165,980,329 (GRCm39) S131P probably damaging Het
Hyal6 T C 6: 24,743,368 (GRCm39) Y355H probably damaging Het
Ide A T 19: 37,249,552 (GRCm39) probably null Het
Ighv5-21 A T 12: 114,283,806 (GRCm39) probably benign Het
Iglc1 A T 16: 18,880,741 (GRCm39) probably benign Het
Impa1 A T 3: 10,381,284 (GRCm39) N199K probably damaging Het
Irx5 A C 8: 93,087,258 (GRCm39) T397P possibly damaging Het
Lonp2 A G 8: 87,368,254 (GRCm39) Y356C probably damaging Het
Matn4 A T 2: 164,246,528 (GRCm39) probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Nav2 T A 7: 49,246,917 (GRCm39) Y2147* probably null Het
Nek5 C T 8: 22,578,817 (GRCm39) probably null Het
Omt2b A G 9: 78,235,839 (GRCm39) M55V probably benign Het
Or5d37 A G 2: 87,924,140 (GRCm39) Y47H probably damaging Het
Or6z1 C A 7: 6,504,842 (GRCm39) V128L probably benign Het
Or9g8 T A 2: 85,607,399 (GRCm39) I157K probably damaging Het
Parp4 T A 14: 56,852,207 (GRCm39) H796Q probably damaging Het
Pex2 T C 3: 5,626,359 (GRCm39) E150G probably benign Het
Poglut2 T C 1: 44,156,260 (GRCm39) N109S probably benign Het
Psmb2 T A 4: 126,578,014 (GRCm39) V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 (GRCm38) R63H probably damaging Het
Ptprd A G 4: 75,900,927 (GRCm39) Y1061H probably damaging Het
Rab23 A G 1: 33,763,967 (GRCm39) probably benign Het
Reg1 C T 6: 78,405,200 (GRCm39) S141L possibly damaging Het
Rock1 A T 18: 10,099,361 (GRCm39) I680K probably benign Het
Sez6l2 A G 7: 126,569,328 (GRCm39) probably benign Het
Slc34a2 A T 5: 53,226,722 (GRCm39) Q615L possibly damaging Het
Slu7 A G 11: 43,334,245 (GRCm39) K424E probably benign Het
Tctn2 A T 5: 124,741,895 (GRCm39) noncoding transcript Het
Tmem87a T A 2: 120,234,605 (GRCm39) probably benign Het
Trappc4 A G 9: 44,315,385 (GRCm39) F198L probably damaging Het
Usp33 C T 3: 152,073,967 (GRCm39) T271I probably benign Het
Vmn1r15 T A 6: 57,235,993 (GRCm39) I287K probably damaging Het
Vmn2r75 A C 7: 85,814,578 (GRCm39) I305R probably benign Het
Wdr26 T C 1: 181,015,106 (GRCm39) probably benign Het
Zzz3 T C 3: 152,156,295 (GRCm39) S684P probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGGACTGTGACAGATCTATTTTG -3'
(R):5'- TGGCACATCTTGTACTCTCATAAC -3'

Sequencing Primer
(F):5'- GGAAAACAATATAGTTTCTTTGC -3'
(R):5'- CCCATTAAAGGGGGAACA -3'
Posted On 2017-02-10