Incidental Mutation 'R5884:Rad51ap2'
ID454586
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene NameRAD51 associated protein 2
Synonyms
MMRRC Submission 044087-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5884 (G1)
Quality Score217
Status Validated
Chromosome12
Chromosomal Location11456079-11462928 bp(+) (GRCm38)
Type of Mutationsmall deletion (5 aa in frame mutation)
DNA Base Change (assembly) GAAAAGGAAACTATTTAAAA to GAAAA at 11457533 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
Predicted Effect probably benign
Transcript: ENSMUST00000124065
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dtx3l C G 16: 35,932,233 E668Q probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Emx2 T G 19: 59,464,029 D248E probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Matn4 A T 2: 164,404,608 probably benign Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Nek5 C T 8: 22,088,801 probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1164 A G 2: 88,093,796 Y47H probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slc34a2 A T 5: 53,069,380 Q615L possibly damaging Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Zzz3 T C 3: 152,450,658 S684P probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11458138 missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11458591 missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11456929 missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11456896 missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11457197 missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11458539 missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11457042 missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11457896 missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11458817 critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11457600 missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11456251 missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11458094 missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11457112 missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11457775 missense probably benign
R1882:Rad51ap2 UTSW 12 11456250 missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11457024 missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11457751 missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11457057 missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11457108 missense probably benign
R2393:Rad51ap2 UTSW 12 11457797 missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11458501 missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11457067 missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11457184 missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11456757 missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11457051 missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11458395 missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11456464 missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11457849 missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11457880 missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11457405 missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11457515 missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11459367 nonsense probably null
R5517:Rad51ap2 UTSW 12 11458312 missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11456920 missense probably damaging 1.00
R5932:Rad51ap2 UTSW 12 11458386 missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11458522 missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11457417 missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11457289 missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11457516 missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11457559 missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11458160 missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11457646 missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11457144 missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11457431 missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11456365 missense probably benign
R7105:Rad51ap2 UTSW 12 11458277 missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11456806 missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11457691 missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11457343 missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11457981 missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11457115 missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11456655 missense probably benign
R7839:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R7916:Rad51ap2 UTSW 12 11456655 missense probably benign
R7922:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R8040:Rad51ap2 UTSW 12 11458791 missense probably benign 0.03
RF023:Rad51ap2 UTSW 12 11458075 missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11458096 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGGACTGTGACAGATCTATTTTG -3'
(R):5'- TGGCACATCTTGTACTCTCATAAC -3'

Sequencing Primer
(F):5'- GGAAAACAATATAGTTTCTTTGC -3'
(R):5'- CCCATTAAAGGGGGAACA -3'
Posted On2017-02-10