Incidental Mutation 'R5884:Emx2'
ID454596
Institutional Source Beutler Lab
Gene Symbol Emx2
Ensembl Gene ENSMUSG00000043969
Gene Nameempty spiracles homeobox 2
SynonymsPdo
MMRRC Submission 044087-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5884 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location59458372-59465357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 59464029 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 248 (D248E)
Ref Sequence ENSEMBL: ENSMUSP00000053361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062216] [ENSMUST00000174353]
Predicted Effect probably damaging
Transcript: ENSMUST00000062216
AA Change: D248E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053361
Gene: ENSMUSG00000043969
AA Change: D248E

DomainStartEndE-ValueType
low complexity region 76 109 N/A INTRINSIC
HOX 155 217 1.32e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174573
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous disruption of this gene causes neonatal death, impaired urogenital development and malformation of several forebrain regions. Heterozygotes for a null allele show middle and inner ear defects. Homozygotes for an ENU-induced allele die neonatally with middle ear defects and small kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dtx3l C G 16: 35,932,233 E668Q probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Matn4 A T 2: 164,404,608 probably benign Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Nek5 C T 8: 22,088,801 probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1164 A G 2: 88,093,796 Y47H probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Rad51ap2 GAAAAGGAAACTATTTAAAA GAAAA 12: 11,457,533 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slc34a2 A T 5: 53,069,380 Q615L possibly damaging Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Zzz3 T C 3: 152,450,658 S684P probably damaging Het
Other mutations in Emx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Emx2 APN 19 59459589 missense possibly damaging 0.83
IGL02103:Emx2 APN 19 59461698 missense probably benign 0.22
R0446:Emx2 UTSW 19 59463916 nonsense probably null
R0631:Emx2 UTSW 19 59464028 missense probably damaging 1.00
R1194:Emx2 UTSW 19 59459552 nonsense probably null
R1512:Emx2 UTSW 19 59459603 missense possibly damaging 0.95
R1526:Emx2 UTSW 19 59464010 missense probably benign 0.05
R2019:Emx2 UTSW 19 59459339 missense probably benign
R2066:Emx2 UTSW 19 59461698 missense probably benign 0.01
R2133:Emx2 UTSW 19 59464033 missense probably damaging 0.99
R4977:Emx2 UTSW 19 59459246 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACAGGCCTCTGGTATATGATAG -3'
(R):5'- TGTCCAAAGTCTGCTGCGAG -3'

Sequencing Primer
(F):5'- GGATCTAAAGATGCCCACTTGTC -3'
(R):5'- GAGCGTCACTGCTCTGATTC -3'
Posted On2017-02-10