Incidental Mutation 'R0555:Ret'
ID 45460
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission 038747-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.818) question?
Stock # R0555 (G1)
Quality Score 201
Status Validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118155571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 375 (V375A)
Ref Sequence ENSEMBL: ENSMUSP00000086169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
Predicted Effect probably damaging
Transcript: ENSMUST00000032201
AA Change: V375A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: V375A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088790
AA Change: V375A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: V375A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Meta Mutation Damage Score 0.0988 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,661,516 (GRCm39) I363N probably damaging Het
Ahcyl2 T C 6: 29,890,670 (GRCm39) probably benign Het
Asap1 A G 15: 63,966,213 (GRCm39) L941P probably damaging Het
Aurka G A 2: 172,209,067 (GRCm39) R23C probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 (GRCm39) H478Q probably damaging Het
Clcn4 C T 7: 7,293,503 (GRCm39) A418T possibly damaging Het
Cplx3 T C 9: 57,521,384 (GRCm39) T193A probably benign Het
Cpxm2 A T 7: 131,645,772 (GRCm39) Y715* probably null Het
Csmd1 T C 8: 16,235,287 (GRCm39) M1179V probably benign Het
Ddx21 A T 10: 62,423,307 (GRCm39) F632I probably damaging Het
Dnai1 C A 4: 41,625,335 (GRCm39) T433K possibly damaging Het
Dpyd G A 3: 119,225,191 (GRCm39) G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,044,862 (GRCm39) probably null Het
Dync1li2 A T 8: 105,147,297 (GRCm39) S466T probably benign Het
Ears2 T C 7: 121,647,667 (GRCm39) T206A probably benign Het
Elmod1 A T 9: 53,838,876 (GRCm39) probably benign Het
Eps8l3 C A 3: 107,799,661 (GRCm39) D590E probably benign Het
Etfdh A T 3: 79,513,112 (GRCm39) H370Q probably benign Het
Fam83g C A 11: 61,598,489 (GRCm39) A792E probably benign Het
Ffar3 G T 7: 30,554,962 (GRCm39) Y119* probably null Het
Fosb G T 7: 19,041,138 (GRCm39) S118R possibly damaging Het
Foxn4 G A 5: 114,401,175 (GRCm39) L3F probably damaging Het
Foxo4 A G X: 100,298,784 (GRCm39) K65E probably damaging Het
Frem2 A G 3: 53,424,281 (GRCm39) L3052P probably damaging Het
Fubp3 G A 2: 31,498,149 (GRCm39) R101H probably damaging Het
Gba2 C A 4: 43,569,927 (GRCm39) G429C probably damaging Het
Gimap1 T C 6: 48,718,363 (GRCm39) probably benign Het
Gnas A G 2: 174,140,304 (GRCm39) T158A possibly damaging Het
Gpc5 T C 14: 115,789,740 (GRCm39) V538A probably damaging Het
Greb1l T C 18: 10,458,781 (GRCm39) probably benign Het
H2-M10.5 G A 17: 37,085,620 (GRCm39) G260R probably damaging Het
Hbs1l A C 10: 21,225,222 (GRCm39) Q412H probably benign Het
Hecw1 G T 13: 14,411,526 (GRCm39) T1058N probably damaging Het
Heph A T X: 95,601,690 (GRCm39) T1027S probably damaging Het
Hoga1 A C 19: 42,034,514 (GRCm39) E53A possibly damaging Het
Insrr T G 3: 87,721,744 (GRCm39) probably benign Het
Ipo11 A T 13: 107,028,969 (GRCm39) V328D probably damaging Het
Jakmip1 T C 5: 37,276,217 (GRCm39) V509A probably damaging Het
Jmjd1c T C 10: 67,061,568 (GRCm39) V1307A probably benign Het
Kmt2a T A 9: 44,758,868 (GRCm39) S1027C probably damaging Het
Kprp G C 3: 92,731,664 (GRCm39) P462R unknown Het
Lrit3 A T 3: 129,584,945 (GRCm39) V271D probably damaging Het
Map4 T A 9: 109,808,171 (GRCm39) probably benign Het
Mark4 A C 7: 19,182,598 (GRCm39) probably benign Het
Mfsd14b A G 13: 65,226,259 (GRCm39) V142A probably benign Het
Mis18bp1 A T 12: 65,208,227 (GRCm39) I162N possibly damaging Het
Mrpl43 A T 19: 44,994,391 (GRCm39) probably benign Het
Mrpl47 A G 3: 32,790,842 (GRCm39) F16S probably benign Het
Myh2 G T 11: 67,069,793 (GRCm39) G380C probably damaging Het
Myo15a T C 11: 60,412,464 (GRCm39) Y3284H probably damaging Het
Nectin2 A G 7: 19,467,148 (GRCm39) probably benign Het
Neu3 A G 7: 99,463,390 (GRCm39) V111A probably damaging Het
Nol4l T C 2: 153,259,604 (GRCm39) probably null Het
Nphp3 C A 9: 103,900,633 (GRCm39) H510Q probably damaging Het
Nprl3 T A 11: 32,183,118 (GRCm39) probably null Het
Or14c39 A G 7: 86,344,516 (GRCm39) N284S probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or52ab7 T C 7: 102,978,170 (GRCm39) V159A probably benign Het
Or6c2 T C 10: 129,362,765 (GRCm39) I223T possibly damaging Het
Pex1 A G 5: 3,656,130 (GRCm39) E319G possibly damaging Het
Pgap6 T C 17: 26,336,088 (GRCm39) L130S probably benign Het
Phtf1 C A 3: 103,911,785 (GRCm39) T709K probably damaging Het
Plek2 A T 12: 78,938,946 (GRCm39) L271Q probably damaging Het
Plekhg5 T A 4: 152,191,926 (GRCm39) C421* probably null Het
Polk A C 13: 96,620,687 (GRCm39) C525W probably damaging Het
Ppfibp2 T C 7: 107,328,381 (GRCm39) S471P probably damaging Het
Prickle2 A T 6: 92,435,546 (GRCm39) F74L probably benign Het
Prl7d1 A T 13: 27,896,038 (GRCm39) V113D probably benign Het
Prr14 C T 7: 127,071,267 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rora T C 9: 69,269,028 (GRCm39) F41S probably damaging Het
Sall1 T C 8: 89,758,386 (GRCm39) T573A probably benign Het
Shb A G 4: 45,458,321 (GRCm39) V281A possibly damaging Het
Slc25a26 A T 6: 94,569,391 (GRCm39) probably null Het
Sltm T C 9: 70,493,363 (GRCm39) F769L probably damaging Het
Snx9 T A 17: 5,968,688 (GRCm39) M328K probably damaging Het
Stk25 G T 1: 93,552,313 (GRCm39) Q356K probably benign Het
Svep1 T A 4: 58,128,858 (GRCm39) Y613F possibly damaging Het
Syne4 G A 7: 30,016,169 (GRCm39) A195T probably damaging Het
Tmem217b A T 17: 29,738,545 (GRCm39) F74I probably benign Het
Trcg1 C T 9: 57,149,616 (GRCm39) T396M probably damaging Het
Trim30b A G 7: 104,006,505 (GRCm39) V117A possibly damaging Het
Trpc4 T C 3: 54,209,511 (GRCm39) probably benign Het
Ttll4 A G 1: 74,727,439 (GRCm39) H827R probably damaging Het
Tut7 A G 13: 59,948,131 (GRCm39) V328A probably benign Het
Urgcp T C 11: 5,667,477 (GRCm39) E287G probably damaging Het
Usp2 G T 9: 44,004,081 (GRCm39) L319F probably damaging Het
Vmn1r167 A T 7: 23,204,512 (GRCm39) V168D probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r61 A T 7: 41,915,442 (GRCm39) I130F probably benign Het
Vmn2r63 A T 7: 42,577,952 (GRCm39) Y195* probably null Het
Vmn2r81 T C 10: 79,129,283 (GRCm39) S725P probably damaging Het
Wnt10b A G 15: 98,670,818 (GRCm39) probably benign Het
Zfp292 T C 4: 34,807,194 (GRCm39) E1950G probably damaging Het
Zfyve16 A G 13: 92,653,028 (GRCm39) probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCTATGCTAACGCTGCACTGGATG -3'
(R):5'- TTGTAAGACTGCCCACCAGACCTG -3'

Sequencing Primer
(F):5'- CCTAACCTCATGCCATGTAATG -3'
(R):5'- GCAGGGTTGGACGTTGG -3'
Posted On 2013-06-11