Incidental Mutation 'R5850:Kdsr'
ID454600
Institutional Source Beutler Lab
Gene Symbol Kdsr
Ensembl Gene ENSMUSG00000009905
Gene Name3-ketodihydrosphingosine reductase
SynonymsFvt1, 6330410P18Rik, 9430079B08Rik
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106720459-106759727 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 106755442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010049]
Predicted Effect probably null
Transcript: ENSMUST00000010049
SMART Domains Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:KR 33 214 9.4e-16 PFAM
Pfam:adh_short 33 232 1.1e-59 PFAM
Pfam:adh_short_C2 39 217 5.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187617
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Kdsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Kdsr APN 1 106755457 missense possibly damaging 0.91
IGL01375:Kdsr APN 1 106727694 missense probably benign 0.06
R0361:Kdsr UTSW 1 106747787 missense probably damaging 0.97
R1051:Kdsr UTSW 1 106747580 nonsense probably null
R1589:Kdsr UTSW 1 106734541 splice site probably null
R1679:Kdsr UTSW 1 106753226 missense probably benign 0.01
R4890:Kdsr UTSW 1 106753234 missense probably benign 0.21
R5392:Kdsr UTSW 1 106753241 missense possibly damaging 0.88
R5500:Kdsr UTSW 1 106759644 unclassified probably benign
R5830:Kdsr UTSW 1 106747532 missense possibly damaging 0.89
R6005:Kdsr UTSW 1 106734581 missense probably benign 0.01
R7515:Kdsr UTSW 1 106734560 missense possibly damaging 0.89
R7841:Kdsr UTSW 1 106743685 missense probably damaging 1.00
R7924:Kdsr UTSW 1 106743685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCTGATTGCTTAGAACAGG -3'
(R):5'- GCATTCCAGGTGACAAATGTG -3'

Sequencing Primer
(F):5'- CCTGATTGCTTAGAACAGGAAAAAC -3'
(R):5'- AGTCCTATGCAGTACTGGAGATCC -3'
Posted On2017-02-10