Incidental Mutation 'R5850:Bcl2l15'
ID454607
Institutional Source Beutler Lab
Gene Symbol Bcl2l15
Ensembl Gene ENSMUSG00000044165
Gene NameBCLl2-like 15
SynonymsBfk, LOC229672
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103832601-103854618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103836116 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 111 (V111D)
Ref Sequence ENSEMBL: ENSMUSP00000102435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062945] [ENSMUST00000106822] [ENSMUST00000199710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062945
AA Change: V111D

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052210
Gene: ENSMUSG00000044165
AA Change: V111D

DomainStartEndE-ValueType
Blast:BCL 60 162 2e-54 BLAST
SCOP:d1k3ka_ 61 165 5e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106822
AA Change: V111D

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102435
Gene: ENSMUSG00000044165
AA Change: V111D

DomainStartEndE-ValueType
Blast:BCL 60 162 2e-54 BLAST
SCOP:d1maz__ 60 162 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199710
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Bcl2l15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Bcl2l15 APN 3 103833414 missense probably damaging 1.00
IGL03323:Bcl2l15 APN 3 103833403 missense probably benign 0.00
R0655:Bcl2l15 UTSW 3 103832969 critical splice donor site probably null
R0788:Bcl2l15 UTSW 3 103833478 critical splice donor site probably null
R1721:Bcl2l15 UTSW 3 103838598 utr 3 prime probably null
R1744:Bcl2l15 UTSW 3 103838540 missense probably damaging 1.00
R1867:Bcl2l15 UTSW 3 103838598 utr 3 prime probably null
R5632:Bcl2l15 UTSW 3 103836062 missense probably benign 0.01
R7485:Bcl2l15 UTSW 3 103833413 missense probably damaging 1.00
R7546:Bcl2l15 UTSW 3 103832887 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCTGAAAGTATGAACTCTGTAGGTG -3'
(R):5'- AGCATGGGACTTAACAGATGC -3'

Sequencing Primer
(F):5'- AAGATGAGATTTGTCCATCTGCCC -3'
(R):5'- GCATGGGACTTAACAGATGCTTACC -3'
Posted On2017-02-10