Incidental Mutation 'R5850:Nmnat1'
ID454614
Institutional Source Beutler Lab
Gene Symbol Nmnat1
Ensembl Gene ENSMUSG00000028992
Gene Namenicotinamide nucleotide adenylyltransferase 1
Synonymsnmnat, 5730441G13Rik, nicotinamide mononucleotide adenylyl transferase, D4Cole1e, 2610529L11Rik
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149467572-149485202 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 149469667 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 139 (Q139*)
Ref Sequence ENSEMBL: ENSMUSP00000113156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030845] [ENSMUST00000105693] [ENSMUST00000119921] [ENSMUST00000126896]
Predicted Effect probably null
Transcript: ENSMUST00000030845
AA Change: Q139*
SMART Domains Protein: ENSMUSP00000030845
Gene: ENSMUSG00000028992
AA Change: Q139*

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 230 2.5e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105693
AA Change: Q139*
SMART Domains Protein: ENSMUSP00000101318
Gene: ENSMUSG00000028992
AA Change: Q139*

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 230 9.5e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119921
AA Change: Q139*
SMART Domains Protein: ENSMUSP00000113156
Gene: ENSMUSG00000028992
AA Change: Q139*

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 140 9.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126896
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes a key step in the biosynthesis of nicotinamide adenine dinucleotide (NAD). The encoded enzyme is one of several nicotinamide nucleotide adenylyltransferases, and is specifically localized to the cell nucleus. Activity of this protein leads to the activation of a nuclear deacetylase that functions in the protection of damaged neurons. Mutations in this gene have been associated with Leber congenital amaurosis 9. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes 1, 3, 4, 14, and 15. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Nmnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01577:Nmnat1 APN 4 149469678 missense possibly damaging 0.94
IGL02943:Nmnat1 APN 4 149473288 missense probably damaging 1.00
R0164:Nmnat1 UTSW 4 149469150 missense possibly damaging 0.78
R0164:Nmnat1 UTSW 4 149469150 missense possibly damaging 0.78
R4363:Nmnat1 UTSW 4 149473445 missense probably benign 0.07
R4583:Nmnat1 UTSW 4 149469151 missense possibly damaging 0.55
R4835:Nmnat1 UTSW 4 149473345 missense possibly damaging 0.92
R4991:Nmnat1 UTSW 4 149469127 missense possibly damaging 0.94
R5073:Nmnat1 UTSW 4 149469138 missense probably benign 0.01
R7249:Nmnat1 UTSW 4 149469642 missense probably null 0.06
R7471:Nmnat1 UTSW 4 149473301 missense probably damaging 1.00
R7602:Nmnat1 UTSW 4 149473351 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATATCATGGACCCAGCAAGTC -3'
(R):5'- TCTTACTGTTGCATACATGTGC -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- CACACACAATACTTCAGAGAGTACTC -3'
Posted On2017-02-10