Mutagenetix > Incidental Mutations

Incidental Mutation 'R5850:Polr1a'

454615

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

043226-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5850 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71926683 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 327 (F327I)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

Predicted Effect

probably benign
Transcript: ENSMUST00000055296
AA Change: F327I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: F327I

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205333

Predicted Effect

probably benign
Transcript: ENSMUST00000206556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206823

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Abhd14a	A	C	9: 106,440,349	L225R	probably damaging	Het
Apbb1	A	G	7: 105,567,583	S39P	probably damaging	Het
Apc	T	C	18: 34,318,063	S2637P	possibly damaging	Het
Apold1	T	C	6: 134,984,095	F171L	probably damaging	Het
Ascc3	T	C	10: 50,710,953	M967T	probably damaging	Het
Atf7ip	T	C	6: 136,566,787		probably null	Het
Bcl2l15	T	A	3: 103,836,116	V111D	possibly damaging	Het
Bsn	A	T	9: 108,114,950	M1201K	probably damaging	Het
Ccdc141	T	A	2: 77,029,403	N965Y	probably damaging	Het
Cnn3	T	C	3: 121,451,928	Y98H	probably damaging	Het
Cnot1	G	A	8: 95,734,147	R117*	probably null	Het
Dlgap1	G	A	17: 70,787,092	V803M	probably damaging	Het
Drd3	A	C	16: 43,818,332	M299L	probably benign	Het
Ergic2	C	A	6: 148,183,107	M34I	possibly damaging	Het
Ext2	A	T	2: 93,813,659	D92E	possibly damaging	Het
Fmnl1	A	G	11: 103,195,285		probably benign	Het
Ganab	C	T	19: 8,911,707	R591W	probably damaging	Het
Kdsr	A	T	1: 106,755,442		probably null	Het
Macf1	T	C	4: 123,507,306	E813G	probably damaging	Het
Nlrc5	A	G	8: 94,521,047	T1621A	probably benign	Het
Nmnat1	G	A	4: 149,469,667	Q139*	probably null	Het
Os9	TTCCTCCTCCTCCTCCTCCTC	TTCCTCCTCCTCCTCCTC	10: 127,098,479		probably benign	Het
Oxa1l	T	G	14: 54,367,664	V11G	possibly damaging	Het
Padi1	A	G	4: 140,814,830	Y594H	probably benign	Het
Prf1	G	T	10: 61,300,193	A83S	probably benign	Het
Ptgs2	A	G	1: 150,105,376	E470G	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc19a2	A	G	1: 164,263,456	I278V	probably benign	Het
Smco1	A	T	16: 32,273,856	N115I	probably damaging	Het
Smyd3	G	A	1: 179,043,855	L320F	probably damaging	Het
Svil	T	A	18: 5,098,900		probably null	Het
Syne2	A	G	12: 76,097,975	D1566G	probably damaging	Het
Tpm2	T	C	4: 43,523,296	D20G	probably damaging	Het
Ubap1l	A	G	9: 65,373,763	Y241C	probably damaging	Het
Usp15	A	G	10: 123,124,512		probably null	Het
Wdr45b	A	G	11: 121,331,097		probably benign	Het
Zc3h14	A	G	12: 98,779,155	I468V	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	not run
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGCTGTCAAACCAAGGTTGC -3'
(R):5'- CACAGTTAGAACCAAGTGTGTAG -3'

Sequencing Primer
(F):5'- CTGTCAAACCAAGGTTGCAGGTAG -3'
(R):5'- CCAAGTGTGTAGTTCTTACCAAACC -3'

Posted On

2017-02-10