Incidental Mutation 'R0555:Ptpro'
ID45462
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0555 (G1)
Quality Score165
Status Validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137443594 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1007 (V1007D)
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: V1035D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V1035D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: V214D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: V214D

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: V1007D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V1007D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: V186D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: V186D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Meta Mutation Damage Score 0.9197 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137426784 nonsense probably null
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGTGATCCTCTGCCAACTTC -3'
(R):5'- CCTTTCAAAAGAATGATGCAGCCCC -3'

Sequencing Primer
(F):5'- TTCGTCATCAGCAAAAACGGC -3'
(R):5'- TGATGCAGCCCCATGAAG -3'
Posted On2013-06-11