Incidental Mutation 'R5850:Zfp703'
ID454621
Institutional Source Beutler Lab
Gene Symbol Zfp703
Ensembl Gene ENSMUSG00000085795
Gene Namezinc finger protein 703
SynonymsZeppo1, End2, 1110032O19Rik, Csmn1
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location26977325-26981461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26979205 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 299 (P299L)
Ref Sequence ENSEMBL: ENSMUSP00000128757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127097] [ENSMUST00000154256] [ENSMUST00000209411] [ENSMUST00000209610]
Predicted Effect probably benign
Transcript: ENSMUST00000127097
SMART Domains Protein: ENSMUSP00000132801
Gene: ENSMUSG00000085795

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154256
AA Change: P299L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128757
Gene: ENSMUSG00000085795
AA Change: P299L

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
low complexity region 164 191 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
low complexity region 261 275 N/A INTRINSIC
Pfam:nlz1 315 369 3.6e-24 PFAM
low complexity region 426 442 N/A INTRINSIC
ZnF_C2H2 460 488 1.16e1 SMART
low complexity region 497 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209411
Predicted Effect probably benign
Transcript: ENSMUST00000209610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210723
Meta Mutation Damage Score 0.5368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Other mutations in Zfp703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Zfp703 APN 8 26980008 missense probably damaging 0.98
R1524:Zfp703 UTSW 8 26979373 missense probably damaging 1.00
R2082:Zfp703 UTSW 8 26978988 missense probably benign 0.01
R4049:Zfp703 UTSW 8 26979085 missense possibly damaging 0.70
R4570:Zfp703 UTSW 8 26978953 missense probably benign 0.10
R4884:Zfp703 UTSW 8 26978701 missense probably benign 0.03
R4929:Zfp703 UTSW 8 26978851 missense possibly damaging 0.66
R4938:Zfp703 UTSW 8 26979773 missense probably damaging 1.00
R4943:Zfp703 UTSW 8 26979591 missense probably benign 0.35
R5117:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5118:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5297:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5465:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5466:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5467:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5492:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5493:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5494:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5757:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5758:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5802:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5828:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5854:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5856:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5959:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R6464:Zfp703 UTSW 8 26979327 missense probably damaging 1.00
R6867:Zfp703 UTSW 8 26978640 missense probably damaging 0.97
R7067:Zfp703 UTSW 8 26979016 missense probably damaging 0.96
R7812:Zfp703 UTSW 8 26979878 missense probably damaging 1.00
R7880:Zfp703 UTSW 8 26978690 missense unknown
R7963:Zfp703 UTSW 8 26978690 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCAGACTGCAAGAACGG -3'
(R):5'- AGTAGGGGTCACGGCATAATC -3'

Sequencing Primer
(F):5'- CTGCAAGAACGGCGGCG -3'
(R):5'- GTCACGGCATAATCCCTGCAG -3'
Posted On2017-02-10