Incidental Mutation 'R5850:Fmnl1'
ID 454633
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R5850 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 103195285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021323] [ENSMUST00000042286] [ENSMUST00000107026] [ENSMUST00000107027] [ENSMUST00000129726] [ENSMUST00000172850] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect noncoding transcript
Transcript: ENSMUST00000021322
Predicted Effect probably benign
Transcript: ENSMUST00000021323
SMART Domains Protein: ENSMUSP00000021323
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 7.23e1 SMART
EFh 145 173 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000042286
AA Change: D742G
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: D742G

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107026
SMART Domains Protein: ENSMUSP00000102641
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 40 68 7.23e1 SMART
EFh 76 104 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107027
AA Change: D742G
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: D742G

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect probably benign
Transcript: ENSMUST00000129726
SMART Domains Protein: ENSMUSP00000133299
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Pfam:FH2 1 50 8.2e-10 PFAM
low complexity region 124 139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect probably benign
Transcript: ENSMUST00000172850
SMART Domains Protein: ENSMUSP00000139837
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 3.5e-1 SMART
EFh 145 173 3.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174079
Predicted Effect unknown
Transcript: ENSMUST00000218163
AA Change: D748G
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103194033 missense unknown
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8946:Fmnl1 UTSW 11 103180915 missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103186618 small deletion probably benign
R9114:Fmnl1 UTSW 11 103196501 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGCCAAAGGATTCATAGCTG -3'
(R):5'- CTGGAAAGTTGCCCAGGAAG -3'

Sequencing Primer
(F):5'- AGGATTCATAGCTGTCTATCTGCCAG -3'
(R):5'- CCCAGGAAGGTGAGTGTGTTC -3'
Posted On 2017-02-10