Mutagenetix > Incidental Mutation

Incidental Mutation 'R0555:Mark4'

45465

Institutional Source

Beutler Lab

Gene Symbol

Mark4

Ensembl Gene

ENSMUSG00000030397

Gene Name

MAP/microtubule affinity regulating kinase 4

Synonyms

Markl1, 2410090P21Rik

MMRRC Submission

038747-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0555 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19424775-19458821 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 19448673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147002 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085715] [ENSMUST00000209058]

AlphaFold

Q8CIP4

Predicted Effect

probably benign
Transcript: ENSMUST00000085715

SMART Domains

Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397

Domain	Start	End	E-Value	Type
S_TKc	59	310	1.4e-109	SMART
UBA	331	368	9.62e-8	SMART
low complexity region	391	408	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC
low complexity region	540	553	N/A	INTRINSIC
low complexity region	580	586	N/A	INTRINSIC
low complexity region	672	690	N/A	INTRINSIC
Pfam:KA1	709	752	1.4e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209011

Predicted Effect

probably benign
Transcript: ENSMUST00000209058

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit insulin hypersensitivity and resistance to diet-induced obersity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	T	A	9: 70,754,234	I363N	probably damaging	Het
Ahcyl2	T	C	6: 29,890,671		probably benign	Het
Asap1	A	G	15: 64,094,364	L941P	probably damaging	Het
Aurka	G	A	2: 172,367,147	R23C	probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Casp8ap2	T	A	4: 32,640,381	H478Q	probably damaging	Het
Clcn4	C	T	7: 7,290,504	A418T	possibly damaging	Het
Cpxm2	A	T	7: 132,044,043	Y715*	probably null	Het
Csmd1	T	C	8: 16,185,273	M1179V	probably benign	Het
Ddx21	A	T	10: 62,587,528	F632I	probably damaging	Het
Dnaic1	C	A	4: 41,625,335	T433K	possibly damaging	Het
Dpyd	G	A	3: 119,431,542	G988D	probably damaging	Het
Dync1i2	AAAAGAAGAGGAAAGAAGAGGAAAG	AAAAGAAGAGGAAAG	2: 71,214,518		probably null	Het
Dync1li2	A	T	8: 104,420,665	S466T	probably benign	Het
Ears2	T	C	7: 122,048,444	T206A	probably benign	Het
Elmod1	A	T	9: 53,931,592		probably benign	Het
Eps8l3	C	A	3: 107,892,345	D590E	probably benign	Het
Etfdh	A	T	3: 79,605,805	H370Q	probably benign	Het
Fam83g	C	A	11: 61,707,663	A792E	probably benign	Het
Ffar3	G	T	7: 30,855,537	Y119*	probably null	Het
Fosb	G	T	7: 19,307,213	S118R	possibly damaging	Het
Foxn4	G	A	5: 114,263,114	L3F	probably damaging	Het
Foxo4	A	G	X: 101,255,178	K65E	probably damaging	Het
Frem2	A	G	3: 53,516,860	L3052P	probably damaging	Het
Fubp3	G	A	2: 31,608,137	R101H	probably damaging	Het
Gba2	C	A	4: 43,569,927	G429C	probably damaging	Het
Gimap1	T	C	6: 48,741,429		probably benign	Het
Gm17657	A	T	17: 29,519,571	F74I	probably benign	Het
Gnas	A	G	2: 174,298,511	T158A	possibly damaging	Het
Gpc5	T	C	14: 115,552,328	V538A	probably damaging	Het
Greb1l	T	C	18: 10,458,781		probably benign	Het
H2-M10.5	G	A	17: 36,774,728	G260R	probably damaging	Het
Hbs1l	A	C	10: 21,349,323	Q412H	probably benign	Het
Hecw1	G	T	13: 14,236,941	T1058N	probably damaging	Het
Heph	A	T	X: 96,558,084	T1027S	probably damaging	Het
Hoga1	A	C	19: 42,046,075	E53A	possibly damaging	Het
Insrr	T	G	3: 87,814,437		probably benign	Het
Ipo11	A	T	13: 106,892,461	V328D	probably damaging	Het
Jakmip1	T	C	5: 37,118,873	V509A	probably damaging	Het
Jmjd1c	T	C	10: 67,225,789	V1307A	probably benign	Het
Kmt2a	T	A	9: 44,847,571	S1027C	probably damaging	Het
Kprp	G	C	3: 92,824,357	P462R	unknown	Het
Lman1l	T	C	9: 57,614,101	T193A	probably benign	Het
Lrit3	A	T	3: 129,791,296	V271D	probably damaging	Het
Map4	T	A	9: 109,979,103		probably benign	Het
Mfsd14b	A	G	13: 65,078,445	V142A	probably benign	Het
Mis18bp1	A	T	12: 65,161,453	I162N	possibly damaging	Het
Mrpl43	A	T	19: 45,005,952		probably benign	Het
Mrpl47	A	G	3: 32,736,693	F16S	probably benign	Het
Myh2	G	T	11: 67,178,967	G380C	probably damaging	Het
Myo15	T	C	11: 60,521,638	Y3284H	probably damaging	Het
Nectin2	A	G	7: 19,733,223		probably benign	Het
Neu3	A	G	7: 99,814,183	V111A	probably damaging	Het
Nol4l	T	C	2: 153,417,684		probably null	Het
Nphp3	C	A	9: 104,023,434	H510Q	probably damaging	Het
Nprl3	T	A	11: 32,233,118		probably null	Het
Olfr292	A	G	7: 86,695,308	N284S	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr598	T	C	7: 103,328,963	V159A	probably benign	Het
Olfr791	T	C	10: 129,526,896	I223T	possibly damaging	Het
Pex1	A	G	5: 3,606,130	E319G	possibly damaging	Het
Phtf1	C	A	3: 104,004,469	T709K	probably damaging	Het
Plek2	A	T	12: 78,892,172	L271Q	probably damaging	Het
Plekhg5	T	A	4: 152,107,469	C421*	probably null	Het
Polk	A	C	13: 96,484,179	C525W	probably damaging	Het
Ppfibp2	T	C	7: 107,729,174	S471P	probably damaging	Het
Prickle2	A	T	6: 92,458,565	F74L	probably benign	Het
Prl7d1	A	T	13: 27,712,055	V113D	probably benign	Het
Prr14	C	T	7: 127,472,095		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ret	A	G	6: 118,178,610	V375A	probably damaging	Het
Rora	T	C	9: 69,361,746	F41S	probably damaging	Het
Sall1	T	C	8: 89,031,758	T573A	probably benign	Het
Shb	A	G	4: 45,458,321	V281A	possibly damaging	Het
Slc25a26	A	T	6: 94,592,410		probably null	Het
Sltm	T	C	9: 70,586,081	F769L	probably damaging	Het
Snx9	T	A	17: 5,918,413	M328K	probably damaging	Het
Stk25	G	T	1: 93,624,591	Q356K	probably benign	Het
Svep1	T	A	4: 58,128,858	Y613F	possibly damaging	Het
Syne4	G	A	7: 30,316,744	A195T	probably damaging	Het
Tmem8	T	C	17: 26,117,114	L130S	probably benign	Het
Trcg1	C	T	9: 57,242,333	T396M	probably damaging	Het
Trim30b	A	G	7: 104,357,298	V117A	possibly damaging	Het
Trpc4	T	C	3: 54,302,090		probably benign	Het
Ttll4	A	G	1: 74,688,280	H827R	probably damaging	Het
Urgcp	T	C	11: 5,717,477	E287G	probably damaging	Het
Usp2	G	T	9: 44,092,784	L319F	probably damaging	Het
Vmn1r167	A	T	7: 23,505,087	V168D	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r61	A	T	7: 42,266,018	I130F	probably benign	Het
Vmn2r63	A	T	7: 42,928,528	Y195*	probably null	Het
Vmn2r81	T	C	10: 79,293,449	S725P	probably damaging	Het
Wnt10b	A	G	15: 98,772,937		probably benign	Het
Zcchc6	A	G	13: 59,800,317	V328A	probably benign	Het
Zfp292	T	C	4: 34,807,194	E1950G	probably damaging	Het
Zfyve16	A	G	13: 92,516,520		probably benign	Het

Other mutations in Mark4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mark4	APN	7	19431824	missense	possibly damaging	0.50
IGL02321:Mark4	APN	7	19426389	missense	probably benign
IGL02813:Mark4	APN	7	19447256	splice site	probably null
IGL03088:Mark4	APN	7	19451584	missense	probably damaging	1.00
breakfast	UTSW	7	19443226	missense	probably damaging	1.00
R3828_Mark4_841	UTSW	7	19443187	missense	possibly damaging	0.65
Towncar	UTSW	7	19447243	missense	possibly damaging	0.95
R1278:Mark4	UTSW	7	19431770	missense	probably damaging	0.99
R1385:Mark4	UTSW	7	19426027	splice site	probably null
R3415:Mark4	UTSW	7	19451725	missense	probably benign	0.00
R3828:Mark4	UTSW	7	19443187	missense	possibly damaging	0.65
R4281:Mark4	UTSW	7	19433446	missense	probably benign	0.09
R4682:Mark4	UTSW	7	19445172	splice site	probably null
R4791:Mark4	UTSW	7	19451657	missense	probably benign	0.19
R5184:Mark4	UTSW	7	19447243	missense	possibly damaging	0.95
R5319:Mark4	UTSW	7	19436961	missense	possibly damaging	0.95
R5330:Mark4	UTSW	7	19436983	missense	probably damaging	1.00
R5488:Mark4	UTSW	7	19429607	splice site	probably null
R5811:Mark4	UTSW	7	19448639	missense	probably damaging	1.00
R6058:Mark4	UTSW	7	19426385	missense	probably benign	0.10
R6148:Mark4	UTSW	7	19429516	missense	probably benign	0.00
R6333:Mark4	UTSW	7	19443283	missense	probably damaging	0.98
R6698:Mark4	UTSW	7	19429437	missense	probably benign	0.01
R7265:Mark4	UTSW	7	19451725	missense	probably benign	0.00
R7429:Mark4	UTSW	7	19426167	missense	probably damaging	0.99
R7664:Mark4	UTSW	7	19443226	missense	probably damaging	1.00
R8027:Mark4	UTSW	7	19447239	missense	possibly damaging	0.71
R9321:Mark4	UTSW	7	19436976	missense	probably benign	0.11
R9610:Mark4	UTSW	7	19433413	missense	possibly damaging	0.46
R9611:Mark4	UTSW	7	19433413	missense	possibly damaging	0.46
R9649:Mark4	UTSW	7	19426090	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GGTTGAGTCCCTTCATAATTCGGACTTC -3'
(R):5'- TCACCACACCTGGGATAAGATTCACTT -3'

Sequencing Primer
(F):5'- AATTCGGACTTCTCTGAACAGC -3'
(R):5'- gtgaaaggagccagggag -3'

Posted On

2013-06-11