Incidental Mutation 'R5851:Lor'
ID 454655
Institutional Source Beutler Lab
Gene Symbol Lor
Ensembl Gene ENSMUSG00000043165
Gene Name loricrin
Synonyms
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5851 (G1)
Quality Score 199
Status Validated
Chromosome 3
Chromosomal Location 92080271-92083142 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 92080539 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 480 (A480V)
Ref Sequence ENSEMBL: ENSMUSP00000052128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058150]
AlphaFold P18165
Predicted Effect unknown
Transcript: ENSMUST00000058150
AA Change: A480V
SMART Domains Protein: ENSMUSP00000052128
Gene: ENSMUSG00000043165
AA Change: A480V

DomainStartEndE-ValueType
Pfam:Loricrin 316 438 2.7e-11 PFAM
Pfam:Loricrin 426 486 1.4e-14 PFAM
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene are runted at birth, have a translucent skin and skin skin barrier defect. The morphological skin phenotype disappears after 4-5 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Celf3 T A 3: 94,479,126 I7N probably damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Itga2b C A 11: 102,457,601 probably benign Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Myo1e G A 9: 70,383,804 G959E probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Pnlip G A 19: 58,673,792 W123* probably null Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc5a9 A G 4: 111,885,600 F432L probably benign Het
Slc6a19 A G 13: 73,691,740 F141S possibly damaging Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tmem245 T C 4: 56,916,770 I53V probably benign Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Lor
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4589:Lor UTSW 3 92081894 frame shift probably null
R2932:Lor UTSW 3 92081878 small deletion probably benign
R4677:Lor UTSW 3 92081743 missense unknown
R5454:Lor UTSW 3 92081482 missense unknown
R6267:Lor UTSW 3 92081812 nonsense probably null
R7219:Lor UTSW 3 92081398 missense unknown
R7430:Lor UTSW 3 92081899 missense unknown
R7780:Lor UTSW 3 92081153 nonsense probably null
R8983:Lor UTSW 3 92081139 missense unknown
RF027:Lor UTSW 3 92081876 small deletion probably benign
RF028:Lor UTSW 3 92081899 frame shift probably null
RF031:Lor UTSW 3 92081876 small deletion probably benign
X0057:Lor UTSW 3 92081878 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGCGACTCAATGGCTTCTTC -3'
(R):5'- TACTCCTCTCAGCAGACCAGTC -3'

Sequencing Primer
(F):5'- ACTCAATGGCTTCTTCTGGGG -3'
(R):5'- GCAGACCAGTCAGACCTCCTG -3'
Posted On 2017-02-10