Incidental Mutation 'R5851:Celf3'
ID454656
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene NameCUGBP, Elav-like family member 3
SynonymsBRUNOL1, CAGH4, 4930415M08Rik, Tnrc4, ERDA4
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R5851 (G1)
Quality Score222
Status Validated
Chromosome3
Chromosomal Location94478295-94492198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94479126 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 7 (I7N)
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000198316] [ENSMUST00000199775] [ENSMUST00000199884] [ENSMUST00000200342]
Predicted Effect probably damaging
Transcript: ENSMUST00000029784
AA Change: I7N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137
AA Change: I7N

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183915
Predicted Effect probably benign
Transcript: ENSMUST00000197558
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect probably benign
Transcript: ENSMUST00000198316
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect probably damaging
Transcript: ENSMUST00000199775
AA Change: I7N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137
AA Change: I7N

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Predicted Effect probably damaging
Transcript: ENSMUST00000200342
AA Change: I7N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137
AA Change: I7N

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Meta Mutation Damage Score 0.8299 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Itga2b C A 11: 102,457,601 probably benign Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lor G A 3: 92,080,539 A480V unknown Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Myo1e G A 9: 70,383,804 G959E probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Pnlip G A 19: 58,673,792 W123* probably null Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc5a9 A G 4: 111,885,600 F432L probably benign Het
Slc6a19 A G 13: 73,691,740 F141S possibly damaging Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tmem245 T C 4: 56,916,770 I53V probably benign Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94488228 missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94486801 missense probably damaging 1.00
IGL03007:Celf3 APN 3 94487137 missense probably benign 0.00
R0180:Celf3 UTSW 3 94485340 missense probably damaging 1.00
R0670:Celf3 UTSW 3 94488230 small deletion probably benign
R1965:Celf3 UTSW 3 94485327 missense probably damaging 1.00
R2232:Celf3 UTSW 3 94480259 splice site probably null
R2566:Celf3 UTSW 3 94488230 small deletion probably benign
R3546:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3547:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3548:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R4015:Celf3 UTSW 3 94487198 missense probably benign 0.02
R4471:Celf3 UTSW 3 94488278 splice site probably null
R4698:Celf3 UTSW 3 94484867 critical splice donor site probably null
R4816:Celf3 UTSW 3 94479222 missense probably damaging 1.00
R4939:Celf3 UTSW 3 94488230 small deletion probably benign
R6277:Celf3 UTSW 3 94485365 missense probably damaging 1.00
R6400:Celf3 UTSW 3 94480286 missense probably damaging 1.00
R6986:Celf3 UTSW 3 94487717 missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94480330 missense probably damaging 0.99
R7556:Celf3 UTSW 3 94480283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGTGTGAAGAGCCCTCC -3'
(R):5'- TCCAAATCAGCCCTTTCCAG -3'

Sequencing Primer
(F):5'- AGCCCTCCTCTGCTCAG -3'
(R):5'- CATCCTTCTTGCCTAGCAGG -3'
Posted On2017-02-10