Mutagenetix > Incidental Mutations

Incidental Mutation 'R5851:Ubap2'

454657

Institutional Source

Beutler Lab

Gene Symbol

Ubap2

Ensembl Gene

ENSMUSG00000028433

Gene Name

ubiquitin-associated protein 2

Synonyms

1190005K07Rik

MMRRC Submission

044067-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R5851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41194313-41275144 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 41206268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 534 (Q534*)

Ref Sequence

ENSEMBL: ENSMUSP00000103703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068] [ENSMUST00000135323]

AlphaFold

Q91VX2

Predicted Effect

probably null
Transcript: ENSMUST00000030143
AA Change: Q535*

SMART Domains

Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: Q535*

Domain	Start	End	E-Value	Type
UBA	53	91	9.62e-8	SMART
low complexity region	115	127	N/A	INTRINSIC
low complexity region	130	144	N/A	INTRINSIC
low complexity region	166	185	N/A	INTRINSIC
low complexity region	256	266	N/A	INTRINSIC
low complexity region	341	358	N/A	INTRINSIC
low complexity region	436	448	N/A	INTRINSIC
Pfam:DUF3697	512	544	1.5e-18	PFAM
low complexity region	583	618	N/A	INTRINSIC
low complexity region	631	644	N/A	INTRINSIC
low complexity region	696	722	N/A	INTRINSIC
low complexity region	744	768	N/A	INTRINSIC
low complexity region	787	800	N/A	INTRINSIC
low complexity region	888	914	N/A	INTRINSIC
low complexity region	1007	1024	N/A	INTRINSIC
low complexity region	1057	1078	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC
low complexity region	1101	1115	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108068
AA Change: Q534*

SMART Domains

Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: Q534*

Domain	Start	End	E-Value	Type
UBA	52	90	9.62e-8	SMART
low complexity region	114	126	N/A	INTRINSIC
low complexity region	129	143	N/A	INTRINSIC
low complexity region	165	184	N/A	INTRINSIC
low complexity region	255	265	N/A	INTRINSIC
low complexity region	340	357	N/A	INTRINSIC
low complexity region	435	447	N/A	INTRINSIC
Pfam:DUF3697	511	543	1.2e-20	PFAM
low complexity region	582	617	N/A	INTRINSIC
low complexity region	630	643	N/A	INTRINSIC
low complexity region	695	721	N/A	INTRINSIC
low complexity region	743	767	N/A	INTRINSIC
low complexity region	786	799	N/A	INTRINSIC
low complexity region	887	913	N/A	INTRINSIC
low complexity region	1006	1023	N/A	INTRINSIC
low complexity region	1056	1077	N/A	INTRINSIC
low complexity region	1083	1097	N/A	INTRINSIC
low complexity region	1100	1114	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135323

SMART Domains

Protein: ENSMUSP00000122256
Gene: ENSMUSG00000028433

Domain	Start	End	E-Value	Type
low complexity region	74	91	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158640

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930404N11Rik	A	T	10: 81,364,877		probably null	Het
Abca2	A	G	2: 25,442,310	N1452D	possibly damaging	Het
Abhd15	T	C	11: 77,518,447	L329P	probably benign	Het
Add3	T	C	19: 53,236,774	S442P	probably damaging	Het
Arhgef18	T	C	8: 3,434,980	F228L	probably damaging	Het
Bptf	A	T	11: 107,110,862	Y475N	probably damaging	Het
C3	T	C	17: 57,211,612	N1257S	probably null	Het
Ccdc94	C	T	17: 55,967,582	S298F	probably damaging	Het
Cd163l1	C	T	7: 140,228,027	P704S	possibly damaging	Het
Cdkl1	A	T	12: 69,756,564	Y179*	probably null	Het
Ceacam1	T	C	7: 25,474,600	N210S	possibly damaging	Het
Celf3	T	A	3: 94,479,126	I7N	probably damaging	Het
Cmpk1	A	G	4: 114,986,970	V55A	possibly damaging	Het
Csrnp1	C	T	9: 119,973,078	G305D	possibly damaging	Het
Dnah3	A	G	7: 120,039,362	S1266P	possibly damaging	Het
Edc4	T	C	8: 105,890,867	L1077P	probably damaging	Het
Efcab1	T	A	16: 14,920,436	L155H	probably damaging	Het
Fam174a	G	A	1: 95,325,143	G157S	probably damaging	Het
Fubp3	T	A	2: 31,598,610	D159E	probably benign	Het
Garem2	C	T	5: 30,114,290	T250M	probably damaging	Het
H2-Eb1	C	T	17: 34,309,771	P92L	probably benign	Het
Ifnl3	G	T	7: 28,523,511	C69F	probably damaging	Het
Itga2b	C	A	11: 102,457,601		probably benign	Het
Klhl33	A	T	14: 50,892,878	D386E	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lor	G	A	3: 92,080,539	A480V	unknown	Het
Msh3	G	T	13: 92,215,522	Q1041K	probably benign	Het
Myo1e	G	A	9: 70,383,804	G959E	probably benign	Het
Nfat5	G	T	8: 107,347,727	V338L	probably damaging	Het
Nrf1	A	G	6: 30,089,976	H18R	possibly damaging	Het
Nup160	A	G	2: 90,707,038	D752G	probably benign	Het
Obscn	A	T	11: 58,994,700	L2489*	probably null	Het
Olfr1184	A	G	2: 88,486,860	I43V	possibly damaging	Het
Olfr638	A	G	7: 104,003,452	E59G	probably benign	Het
Paip1	T	C	13: 119,440,765	S215P	possibly damaging	Het
Pate2	T	A	9: 35,670,501	Y26*	probably null	Het
Pcdhb10	A	G	18: 37,412,758	I296V	probably benign	Het
Pdzph1	T	G	17: 58,973,746	T514P	probably benign	Het
Pnlip	G	A	19: 58,673,792	W123*	probably null	Het
Prmt2	C	A	10: 76,236,740	C9F	possibly damaging	Het
Rbl1	T	A	2: 157,167,325	K763N	probably benign	Het
Rfk	C	T	19: 17,395,198	A28V	probably damaging	Het
Sdk1	G	A	5: 141,962,669	V590I	probably benign	Het
Sele	A	G	1: 164,049,574	K140E	probably benign	Het
Skiv2l2	G	A	13: 112,908,952	R349W	probably damaging	Het
Sla	G	A	15: 66,783,723	T189I	probably damaging	Het
Slc46a2	A	G	4: 59,913,906	V339A	probably damaging	Het
Slc5a9	A	G	4: 111,885,600	F432L	probably benign	Het
Slc6a19	A	G	13: 73,691,740	F141S	possibly damaging	Het
Tas2r123	T	C	6: 132,847,308	L56S	probably damaging	Het
Tmem245	T	C	4: 56,916,770	I53V	probably benign	Het
Tor2a	A	T	2: 32,761,607	Q278L	probably benign	Het
Trav6-3	A	G	14: 53,430,115	M15V	probably benign	Het
Ttc28	G	A	5: 111,235,469		probably benign	Het
Zfp954	C	A	7: 7,115,625	E307*	probably null	Het
Zscan21	A	G	5: 138,126,478	K219E	probably benign	Het

Other mutations in Ubap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Ubap2	APN	4	41195328	splice site	probably benign
IGL01109:Ubap2	APN	4	41195155	missense	probably damaging	1.00
IGL01354:Ubap2	APN	4	41207005	missense	probably damaging	1.00
IGL01563:Ubap2	APN	4	41195998	missense	probably damaging	0.96
IGL01602:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01605:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01688:Ubap2	APN	4	41226308	missense	probably benign
IGL01733:Ubap2	APN	4	41195862	unclassified	probably benign
IGL01896:Ubap2	APN	4	41202362	missense	possibly damaging	0.85
IGL01942:Ubap2	APN	4	41251608	missense	probably benign	0.00
IGL02095:Ubap2	APN	4	41229709	missense	probably benign
R0608:Ubap2	UTSW	4	41218319	missense	probably benign	0.10
R0938:Ubap2	UTSW	4	41202304	missense	probably damaging	1.00
R1449:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R1484:Ubap2	UTSW	4	41235593	missense	probably damaging	1.00
R1548:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1549:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1604:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1607:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1739:Ubap2	UTSW	4	41206849	missense	probably benign	0.00
R1772:Ubap2	UTSW	4	41202380	missense	probably benign	0.02
R1862:Ubap2	UTSW	4	41221607	missense	probably benign
R1869:Ubap2	UTSW	4	41233617	missense	probably damaging	1.00
R1886:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1887:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2063:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2064:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2065:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2066:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2095:Ubap2	UTSW	4	41206901	missense	possibly damaging	0.68
R2214:Ubap2	UTSW	4	41199714	critical splice donor site	probably null
R2215:Ubap2	UTSW	4	41196483	splice site	probably null
R2318:Ubap2	UTSW	4	41251542	missense	probably damaging	0.99
R3755:Ubap2	UTSW	4	41195482	missense	probably damaging	1.00
R4620:Ubap2	UTSW	4	41233698	missense	probably damaging	1.00
R4717:Ubap2	UTSW	4	41218333	missense	possibly damaging	0.93
R4756:Ubap2	UTSW	4	41211771	missense	probably damaging	1.00
R4942:Ubap2	UTSW	4	41245461	intron	probably benign
R5344:Ubap2	UTSW	4	41251578	missense	possibly damaging	0.46
R5763:Ubap2	UTSW	4	41195809	missense	probably damaging	1.00
R5951:Ubap2	UTSW	4	41205753	splice site	probably null
R6178:Ubap2	UTSW	4	41206981	missense	probably benign
R6489:Ubap2	UTSW	4	41203574	critical splice acceptor site	probably null
R6520:Ubap2	UTSW	4	41195155	missense	probably damaging	1.00
R6652:Ubap2	UTSW	4	41196743	missense	possibly damaging	0.68
R6702:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227224	small insertion	probably benign
R6860:Ubap2	UTSW	4	41233631	missense	probably damaging	1.00
R7007:Ubap2	UTSW	4	41206221	missense	probably damaging	0.97
R7048:Ubap2	UTSW	4	41196033	missense	possibly damaging	0.49
R7121:Ubap2	UTSW	4	41205550	missense	probably benign	0.00
R7371:Ubap2	UTSW	4	41195779	missense	probably benign	0.16
R7378:Ubap2	UTSW	4	41235515	critical splice donor site	probably null
R7695:Ubap2	UTSW	4	41211740	missense	probably damaging	0.98
R7811:Ubap2	UTSW	4	41211710	missense	probably benign	0.22
R7828:Ubap2	UTSW	4	41221615	missense	probably benign	0.00
R7838:Ubap2	UTSW	4	41233655	missense	probably damaging	1.00
R8016:Ubap2	UTSW	4	41195201	missense	possibly damaging	0.91
R8790:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R8817:Ubap2	UTSW	4	41223425	missense	possibly damaging	0.66
R9379:Ubap2	UTSW	4	41216630	missense	possibly damaging	0.67
R9470:Ubap2	UTSW	4	41195434	missense	possibly damaging	0.64
X0061:Ubap2	UTSW	4	41196507	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCTCTTGACTCCATTTTGGC -3'
(R):5'- CCACTTCCTCACTGTTCAAAAGG -3'

Sequencing Primer
(F):5'- CTTGATTTGCAAAGAAAGGACTACGC -3'
(R):5'- CACTGTTCAAAAGGTTCTTTTTCC -3'

Posted On

2017-02-10