Incidental Mutation 'R5851:Tmem245'
ID454658
Institutional Source Beutler Lab
Gene Symbol Tmem245
Ensembl Gene ENSMUSG00000055296
Gene Nametransmembrane protein 245
Synonyms
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.715) question?
Stock #R5851 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56866923-56947437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56916770 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 53 (I53V)
Ref Sequence ENSEMBL: ENSMUSP00000117449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068792] [ENSMUST00000107609] [ENSMUST00000132816]
Predicted Effect probably benign
Transcript: ENSMUST00000068792
AA Change: I458V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000067421
Gene: ENSMUSG00000055296
AA Change: I458V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
Pfam:UPF0118 589 838 1.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082661
Predicted Effect probably benign
Transcript: ENSMUST00000107609
AA Change: I450V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103234
Gene: ENSMUSG00000055296
AA Change: I450V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
Pfam:UPF0118 585 842 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125082
Predicted Effect probably benign
Transcript: ENSMUST00000132816
AA Change: I53V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117449
Gene: ENSMUSG00000055296
AA Change: I53V

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:UPF0118 182 433 4.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155625
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Celf3 T A 3: 94,479,126 I7N probably damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Itga2b C A 11: 102,457,601 probably benign Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lor G A 3: 92,080,539 A480V unknown Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Myo1e G A 9: 70,383,804 G959E probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Pnlip G A 19: 58,673,792 W123* probably null Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc5a9 A G 4: 111,885,600 F432L probably benign Het
Slc6a19 A G 13: 73,691,740 F141S possibly damaging Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Tmem245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02472:Tmem245 APN 4 56899119 missense probably damaging 1.00
IGL02668:Tmem245 APN 4 56925081 missense possibly damaging 0.86
IGL03093:Tmem245 APN 4 56886019 missense probably damaging 1.00
R0090:Tmem245 UTSW 4 56899410 missense probably benign
R0116:Tmem245 UTSW 4 56926213 missense probably benign 0.00
R0648:Tmem245 UTSW 4 56906270 missense probably benign 0.38
R0864:Tmem245 UTSW 4 56890837 missense probably damaging 1.00
R1102:Tmem245 UTSW 4 56903200 intron probably benign
R1548:Tmem245 UTSW 4 56906233 nonsense probably null
R1778:Tmem245 UTSW 4 56903968 missense probably damaging 1.00
R1840:Tmem245 UTSW 4 56903947 missense probably benign 0.03
R1942:Tmem245 UTSW 4 56923511 unclassified probably benign
R1969:Tmem245 UTSW 4 56937964 missense probably benign 0.01
R2341:Tmem245 UTSW 4 56937957 missense probably damaging 1.00
R2364:Tmem245 UTSW 4 56899391 missense probably damaging 0.96
R3848:Tmem245 UTSW 4 56926298 unclassified probably benign
R4591:Tmem245 UTSW 4 56910204 missense probably damaging 0.99
R4772:Tmem245 UTSW 4 56937989 splice site probably null
R4779:Tmem245 UTSW 4 56936468 missense possibly damaging 0.65
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R5049:Tmem245 UTSW 4 56925057 missense probably benign 0.12
R5061:Tmem245 UTSW 4 56946945 missense possibly damaging 0.94
R5199:Tmem245 UTSW 4 56925149 missense probably benign 0.12
R5377:Tmem245 UTSW 4 56947084 missense probably damaging 0.99
R5547:Tmem245 UTSW 4 56910156 critical splice donor site probably null
R5846:Tmem245 UTSW 4 56903241 missense probably benign 0.00
R5991:Tmem245 UTSW 4 56916733 missense probably damaging 1.00
R6314:Tmem245 UTSW 4 56888592 missense possibly damaging 0.88
R6992:Tmem245 UTSW 4 56937940 missense probably benign 0.03
R7172:Tmem245 UTSW 4 56903946 missense possibly damaging 0.65
R7632:Tmem245 UTSW 4 56916787 missense probably benign 0.00
R7660:Tmem245 UTSW 4 56899170 missense possibly damaging 0.79
R7672:Tmem245 UTSW 4 56947069 missense probably benign
R7735:Tmem245 UTSW 4 56925155 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACTTTAGTGAGCAGAGGTACTTCTG -3'
(R):5'- AGCCATGACAATAATGAACTCTGC -3'

Sequencing Primer
(F):5'- GCAGAGGTACTTCTGATAAGCC -3'
(R):5'- TAATGAACTCTGCACATAACAGC -3'
Posted On2017-02-10