Incidental Mutation 'R0555:Nectin2'
ID45466
Institutional Source Beutler Lab
Gene Symbol Nectin2
Ensembl Gene ENSMUSG00000062300
Gene Namenectin cell adhesion molecule 2
SynonymsMPH, nectin-2, Cd112, Pvs, Pvrl2
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R0555 (G1)
Quality Score159
Status Validated
Chromosome7
Chromosomal Location19716644-19750483 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 19733223 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075447] [ENSMUST00000108450]
Predicted Effect probably benign
Transcript: ENSMUST00000075447
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108450
SMART Domains Protein: ENSMUSP00000104089
Gene: ENSMUSG00000062300

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 416 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207271
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V-type domain. This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Variations in this gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted null mutations exhibit male sterility associated with sperm head and midpiece malformation, impaired zona binding, and lack of oocyte penetration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Nectin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Nectin2 APN 7 19717562 missense probably damaging 1.00
IGL03184:Nectin2 APN 7 19738306 missense possibly damaging 0.86
PIT4458001:Nectin2 UTSW 7 19738327 missense probably benign 0.19
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0764:Nectin2 UTSW 7 19749171 intron probably null
R1252:Nectin2 UTSW 7 19717598 missense probably benign 0.18
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1833:Nectin2 UTSW 7 19717708 missense probably damaging 0.96
R2115:Nectin2 UTSW 7 19717564 missense probably damaging 0.98
R2168:Nectin2 UTSW 7 19730614 missense probably damaging 0.98
R3801:Nectin2 UTSW 7 19717636 missense probably benign
R3825:Nectin2 UTSW 7 19724585 missense possibly damaging 0.94
R4877:Nectin2 UTSW 7 19717720 missense possibly damaging 0.55
R5062:Nectin2 UTSW 7 19738273 missense probably benign 0.09
R5082:Nectin2 UTSW 7 19738124 missense probably damaging 0.99
R5693:Nectin2 UTSW 7 19724869 missense probably benign 0.00
R6042:Nectin2 UTSW 7 19738138 missense probably benign 0.01
R6060:Nectin2 UTSW 7 19717775 missense probably damaging 1.00
R6657:Nectin2 UTSW 7 19738140 missense probably benign 0.41
R7437:Nectin2 UTSW 7 19749268 nonsense probably null
R7476:Nectin2 UTSW 7 19717621 missense possibly damaging 0.82
R7523:Nectin2 UTSW 7 19730112 missense probably benign 0.00
R7538:Nectin2 UTSW 7 19730619 missense probably damaging 1.00
R7910:Nectin2 UTSW 7 19732987 nonsense probably null
R7991:Nectin2 UTSW 7 19732987 nonsense probably null
Z1176:Nectin2 UTSW 7 19738363 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACCATAGGCAAGGCAAGGTTTGGC -3'
(R):5'- CCATGCATCAGTCCCATGTGACATC -3'

Sequencing Primer
(F):5'- ACGTGACCTTGACGCCATC -3'
(R):5'- ATAGTTTAACTGGCTGCCCAGAG -3'
Posted On2013-06-11