Incidental Mutation 'R5851:Slc5a9'
ID454660
Institutional Source Beutler Lab
Gene Symbol Slc5a9
Ensembl Gene ENSMUSG00000028544
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 9
SynonymsSGLT4
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5851 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location111875375-111902918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111885600 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 432 (F432L)
Ref Sequence ENSEMBL: ENSMUSP00000099782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721] [ENSMUST00000128340]
Predicted Effect probably benign
Transcript: ENSMUST00000102719
AA Change: F432L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544
AA Change: F432L

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102720
AA Change: F432L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544
AA Change: F432L

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102721
AA Change: F432L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544
AA Change: F432L

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128224
Predicted Effect probably benign
Transcript: ENSMUST00000128340
SMART Domains Protein: ENSMUSP00000120546
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
Pfam:SSF 23 255 9.3e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154838
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Celf3 T A 3: 94,479,126 I7N probably damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Itga2b C A 11: 102,457,601 probably benign Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lor G A 3: 92,080,539 A480V unknown Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Myo1e G A 9: 70,383,804 G959E probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Pnlip G A 19: 58,673,792 W123* probably null Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc6a19 A G 13: 73,691,740 F141S possibly damaging Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tmem245 T C 4: 56,916,770 I53V probably benign Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Slc5a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Slc5a9 APN 4 111898569 missense probably damaging 0.99
IGL00837:Slc5a9 APN 4 111893690 intron probably benign
IGL01556:Slc5a9 APN 4 111898636 missense probably benign 0.00
IGL01807:Slc5a9 APN 4 111877540 makesense probably null
IGL01816:Slc5a9 APN 4 111898614 missense probably damaging 1.00
IGL02066:Slc5a9 APN 4 111887522 missense probably damaging 1.00
IGL02370:Slc5a9 APN 4 111877629 missense probably benign 0.01
IGL02491:Slc5a9 APN 4 111896352 missense probably damaging 0.99
IGL02971:Slc5a9 APN 4 111890300 missense possibly damaging 0.58
IGL03008:Slc5a9 APN 4 111890941 missense probably benign 0.14
R0365:Slc5a9 UTSW 4 111891836 nonsense probably null
R0559:Slc5a9 UTSW 4 111885582 missense probably benign 0.02
R0659:Slc5a9 UTSW 4 111883871 missense possibly damaging 0.82
R1454:Slc5a9 UTSW 4 111883964 missense probably benign 0.04
R2006:Slc5a9 UTSW 4 111880226 missense probably benign
R2014:Slc5a9 UTSW 4 111896349 missense possibly damaging 0.76
R2024:Slc5a9 UTSW 4 111890531 missense probably damaging 1.00
R2076:Slc5a9 UTSW 4 111885573 missense possibly damaging 0.76
R2152:Slc5a9 UTSW 4 111893223 missense possibly damaging 0.76
R3156:Slc5a9 UTSW 4 111890224 missense possibly damaging 0.80
R4566:Slc5a9 UTSW 4 111891744 intron probably null
R4568:Slc5a9 UTSW 4 111891744 intron probably null
R4579:Slc5a9 UTSW 4 111893187 missense probably damaging 1.00
R4656:Slc5a9 UTSW 4 111891744 intron probably null
R4657:Slc5a9 UTSW 4 111891744 intron probably null
R4700:Slc5a9 UTSW 4 111890937 missense possibly damaging 0.64
R4889:Slc5a9 UTSW 4 111891744 intron probably null
R4891:Slc5a9 UTSW 4 111891744 intron probably null
R4911:Slc5a9 UTSW 4 111891744 intron probably null
R4948:Slc5a9 UTSW 4 111891744 intron probably null
R4953:Slc5a9 UTSW 4 111891744 intron probably null
R5222:Slc5a9 UTSW 4 111898611 missense possibly damaging 0.55
R5376:Slc5a9 UTSW 4 111893217 missense possibly damaging 0.80
R5502:Slc5a9 UTSW 4 111893169 nonsense probably null
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6125:Slc5a9 UTSW 4 111883805 missense probably damaging 1.00
R6326:Slc5a9 UTSW 4 111880253 missense probably benign
R6438:Slc5a9 UTSW 4 111891825 missense probably benign 0.00
R7105:Slc5a9 UTSW 4 111898695 missense probably benign
R7166:Slc5a9 UTSW 4 111883839 missense probably benign 0.04
R7489:Slc5a9 UTSW 4 111883916 missense probably damaging 1.00
R7599:Slc5a9 UTSW 4 111877740 missense probably benign
R7662:Slc5a9 UTSW 4 111877540 makesense probably null
X0012:Slc5a9 UTSW 4 111893314 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGACTTTGTGACGTGTGG -3'
(R):5'- AAAGGTTTCTTGAATTCTGGAGCTC -3'

Sequencing Primer
(F):5'- ACTTTGTGACGTGTGGGGGAG -3'
(R):5'- CTGGAGCTCTAAGTCATAGGATC -3'
Posted On2017-02-10