Mutagenetix > Incidental Mutations

Incidental Mutation 'R5851:Ttc28'

454662

Institutional Source

Beutler Lab

Gene Symbol

Ttc28

Ensembl Gene

ENSMUSG00000033209

Gene Name

tetratricopeptide repeat domain 28

Synonyms

MMRRC Submission

044067-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110879803-111289780 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 111235469 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]

Predicted Effect

probably benign
Transcript: ENSMUST00000040111

SMART Domains

Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	339	372	1.78e-1	SMART
TPR	379	412	2.82e-4	SMART
TPR	419	452	9.98e-5	SMART
TPR	459	492	1.88e0	SMART
TPR	499	532	1.11e1	SMART
TPR	539	572	2.93e-2	SMART
TPR	579	612	1.21e-3	SMART
TPR	619	652	4.91e-4	SMART
TPR	659	692	7.56e-5	SMART
TPR	699	732	8.29e0	SMART
TPR	739	772	1.63e0	SMART
TPR	779	812	1.24e0	SMART
TPR	819	852	7.98e-4	SMART
TPR	859	892	8.74e0	SMART
TPR	902	935	5.43e-6	SMART
TPR	942	975	4.09e-1	SMART
TPR	982	1015	9.98e-5	SMART
TPR	1022	1055	7.12e-1	SMART
TPR	1062	1095	5.69e0	SMART
TPR	1102	1135	3.14e-2	SMART
TPR	1142	1175	2.84e1	SMART
low complexity region	1259	1277	N/A	INTRINSIC
Pfam:CHAT	1415	1738	7.3e-77	PFAM
low complexity region	1972	1990	N/A	INTRINSIC
low complexity region	2014	2031	N/A	INTRINSIC
low complexity region	2033	2045	N/A	INTRINSIC
low complexity region	2155	2171	N/A	INTRINSIC
low complexity region	2283	2293	N/A	INTRINSIC
low complexity region	2327	2352	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129017

Predicted Effect

probably benign
Transcript: ENSMUST00000156290

SMART Domains

Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	308	341	1.78e-1	SMART
TPR	348	381	2.82e-4	SMART
TPR	388	421	9.98e-5	SMART
TPR	428	461	1.88e0	SMART
TPR	468	501	1.11e1	SMART
TPR	508	541	2.93e-2	SMART
TPR	548	581	1.21e-3	SMART
TPR	588	621	4.91e-4	SMART
TPR	628	661	7.56e-5	SMART
TPR	668	701	8.29e0	SMART
TPR	708	741	1.63e0	SMART
TPR	748	781	1.24e0	SMART
TPR	788	821	7.98e-4	SMART
TPR	828	861	8.74e0	SMART
TPR	871	904	5.43e-6	SMART
TPR	911	944	4.09e-1	SMART
TPR	951	984	9.98e-5	SMART
TPR	991	1024	7.12e-1	SMART
TPR	1031	1064	5.69e0	SMART
TPR	1071	1104	3.14e-2	SMART
TPR	1111	1144	2.84e1	SMART
low complexity region	1228	1246	N/A	INTRINSIC
Pfam:CHAT	1384	1707	1.1e-76	PFAM
low complexity region	1941	1959	N/A	INTRINSIC
low complexity region	1983	2000	N/A	INTRINSIC
low complexity region	2002	2014	N/A	INTRINSIC
low complexity region	2124	2140	N/A	INTRINSIC
low complexity region	2252	2262	N/A	INTRINSIC
low complexity region	2296	2321	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (75/75)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930404N11Rik	A	T	10: 81,364,877		probably null	Het
Abca2	A	G	2: 25,442,310	N1452D	possibly damaging	Het
Abhd15	T	C	11: 77,518,447	L329P	probably benign	Het
Add3	T	C	19: 53,236,774	S442P	probably damaging	Het
Arhgef18	T	C	8: 3,434,980	F228L	probably damaging	Het
Bptf	A	T	11: 107,110,862	Y475N	probably damaging	Het
C3	T	C	17: 57,211,612	N1257S	probably null	Het
Ccdc94	C	T	17: 55,967,582	S298F	probably damaging	Het
Cd163l1	C	T	7: 140,228,027	P704S	possibly damaging	Het
Cdkl1	A	T	12: 69,756,564	Y179*	probably null	Het
Ceacam1	T	C	7: 25,474,600	N210S	possibly damaging	Het
Celf3	T	A	3: 94,479,126	I7N	probably damaging	Het
Cmpk1	A	G	4: 114,986,970	V55A	possibly damaging	Het
Csrnp1	C	T	9: 119,973,078	G305D	possibly damaging	Het
Dnah3	A	G	7: 120,039,362	S1266P	possibly damaging	Het
Edc4	T	C	8: 105,890,867	L1077P	probably damaging	Het
Efcab1	T	A	16: 14,920,436	L155H	probably damaging	Het
Fam174a	G	A	1: 95,325,143	G157S	probably damaging	Het
Fubp3	T	A	2: 31,598,610	D159E	probably benign	Het
Garem2	C	T	5: 30,114,290	T250M	probably damaging	Het
H2-Eb1	C	T	17: 34,309,771	P92L	probably benign	Het
Ifnl3	G	T	7: 28,523,511	C69F	probably damaging	Het
Itga2b	C	A	11: 102,457,601		probably benign	Het
Klhl33	A	T	14: 50,892,878	D386E	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lor	G	A	3: 92,080,539	A480V	unknown	Het
Msh3	G	T	13: 92,215,522	Q1041K	probably benign	Het
Myo1e	G	A	9: 70,383,804	G959E	probably benign	Het
Nfat5	G	T	8: 107,347,727	V338L	probably damaging	Het
Nrf1	A	G	6: 30,089,976	H18R	possibly damaging	Het
Nup160	A	G	2: 90,707,038	D752G	probably benign	Het
Obscn	A	T	11: 58,994,700	L2489*	probably null	Het
Olfr1184	A	G	2: 88,486,860	I43V	possibly damaging	Het
Olfr638	A	G	7: 104,003,452	E59G	probably benign	Het
Paip1	T	C	13: 119,440,765	S215P	possibly damaging	Het
Pate2	T	A	9: 35,670,501	Y26*	probably null	Het
Pcdhb10	A	G	18: 37,412,758	I296V	probably benign	Het
Pdzph1	T	G	17: 58,973,746	T514P	probably benign	Het
Pnlip	G	A	19: 58,673,792	W123*	probably null	Het
Prmt2	C	A	10: 76,236,740	C9F	possibly damaging	Het
Rbl1	T	A	2: 157,167,325	K763N	probably benign	Het
Rfk	C	T	19: 17,395,198	A28V	probably damaging	Het
Sdk1	G	A	5: 141,962,669	V590I	probably benign	Het
Sele	A	G	1: 164,049,574	K140E	probably benign	Het
Skiv2l2	G	A	13: 112,908,952	R349W	probably damaging	Het
Sla	G	A	15: 66,783,723	T189I	probably damaging	Het
Slc46a2	A	G	4: 59,913,906	V339A	probably damaging	Het
Slc5a9	A	G	4: 111,885,600	F432L	probably benign	Het
Slc6a19	A	G	13: 73,691,740	F141S	possibly damaging	Het
Tas2r123	T	C	6: 132,847,308	L56S	probably damaging	Het
Tmem245	T	C	4: 56,916,770	I53V	probably benign	Het
Tor2a	A	T	2: 32,761,607	Q278L	probably benign	Het
Trav6-3	A	G	14: 53,430,115	M15V	probably benign	Het
Ubap2	G	A	4: 41,206,268	Q534*	probably null	Het
Zfp954	C	A	7: 7,115,625	E307*	probably null	Het
Zscan21	A	G	5: 138,126,478	K219E	probably benign	Het

Other mutations in Ttc28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Ttc28	APN	5	111225688	missense	probably damaging	1.00
IGL00963:Ttc28	APN	5	111286389	nonsense	probably null
IGL00969:Ttc28	APN	5	111225740	missense	probably benign	0.00
IGL01366:Ttc28	APN	5	111085171	critical splice donor site	probably null
IGL01528:Ttc28	APN	5	111101960	splice site	probably benign
IGL01558:Ttc28	APN	5	111283962	missense	probably damaging	0.99
IGL01973:Ttc28	APN	5	111224235	missense	possibly damaging	0.88
IGL02040:Ttc28	APN	5	110892936	nonsense	probably null
IGL02432:Ttc28	APN	5	111223235	missense	probably damaging	1.00
IGL02531:Ttc28	APN	5	111225850	missense	probably damaging	1.00
IGL02819:Ttc28	APN	5	111266583	missense	probably benign
IGL02830:Ttc28	APN	5	111286239	missense	probably benign	0.10
IGL02893:Ttc28	APN	5	111285385	missense	possibly damaging	0.87
IGL03387:Ttc28	APN	5	111233342	missense	probably benign	0.07
PIT4131001:Ttc28	UTSW	5	110892853	missense	probably benign	0.00
R0142:Ttc28	UTSW	5	111277457	missense	probably benign	0.40
R0166:Ttc28	UTSW	5	111225634	missense	probably benign	0.01
R0328:Ttc28	UTSW	5	111284067	splice site	probably benign
R0582:Ttc28	UTSW	5	111183296	missense	probably damaging	1.00
R0744:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R0811:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0812:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0828:Ttc28	UTSW	5	111223446	missense	probably damaging	1.00
R0833:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R1013:Ttc28	UTSW	5	111276965	missense	probably benign	0.01
R1168:Ttc28	UTSW	5	111231111	missense	probably damaging	1.00
R1194:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1196:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1205:Ttc28	UTSW	5	111285769	missense	probably benign	0.04
R1386:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1537:Ttc28	UTSW	5	111285318	missense	probably damaging	0.96
R1539:Ttc28	UTSW	5	111100811	missense	possibly damaging	0.77
R1558:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1560:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1561:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1566:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1768:Ttc28	UTSW	5	111277168	missense	possibly damaging	0.77
R1775:Ttc28	UTSW	5	111276811	missense	probably benign	0.00
R1909:Ttc28	UTSW	5	111284054	critical splice donor site	probably null
R1911:Ttc28	UTSW	5	111280750	missense	possibly damaging	0.93
R1970:Ttc28	UTSW	5	111235635	missense	probably benign	0.00
R1990:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R1992:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R2066:Ttc28	UTSW	5	111225933	missense	probably benign	0.01
R2112:Ttc28	UTSW	5	111276273	missense	probably damaging	0.99
R2158:Ttc28	UTSW	5	111177617	intron	probably benign
R2192:Ttc28	UTSW	5	111223496	missense	probably damaging	0.99
R2267:Ttc28	UTSW	5	111226003	missense	possibly damaging	0.75
R2384:Ttc28	UTSW	5	111276208	missense	possibly damaging	0.95
R2989:Ttc28	UTSW	5	111224015	missense	probably benign	0.29
R3881:Ttc28	UTSW	5	111183240	missense	probably damaging	1.00
R3919:Ttc28	UTSW	5	111285379	missense	possibly damaging	0.80
R4455:Ttc28	UTSW	5	111224058	frame shift	probably null
R4456:Ttc28	UTSW	5	111224058	frame shift	probably null
R4522:Ttc28	UTSW	5	111280172	missense	probably benign	0.01
R4548:Ttc28	UTSW	5	111271224	missense	possibly damaging	0.86
R4591:Ttc28	UTSW	5	111223281	missense	probably damaging	1.00
R4633:Ttc28	UTSW	5	111224001	missense	probably damaging	1.00
R4700:Ttc28	UTSW	5	111277043	missense	probably damaging	1.00
R4714:Ttc28	UTSW	5	111285229	missense	possibly damaging	0.65
R4790:Ttc28	UTSW	5	111224217	missense	possibly damaging	0.94
R4803:Ttc28	UTSW	5	111277463	missense	possibly damaging	0.90
R4840:Ttc28	UTSW	5	111286081	missense	probably damaging	1.00
R4969:Ttc28	UTSW	5	111276255	missense	probably damaging	0.96
R5019:Ttc28	UTSW	5	111102064	missense	possibly damaging	0.47
R5130:Ttc28	UTSW	5	110892856	missense	probably benign
R5150:Ttc28	UTSW	5	111225689	missense	probably damaging	1.00
R5214:Ttc28	UTSW	5	111177623	intron	probably benign
R5254:Ttc28	UTSW	5	111271238	missense	probably benign	0.01
R5518:Ttc28	UTSW	5	111225928	missense	probably benign	0.17
R5931:Ttc28	UTSW	5	111085109	missense	possibly damaging	0.81
R6011:Ttc28	UTSW	5	111286443	missense	probably benign
R6176:Ttc28	UTSW	5	111223985	missense	probably damaging	1.00
R6221:Ttc28	UTSW	5	111271248	missense	probably benign	0.00
R6398:Ttc28	UTSW	5	111276276	missense	probably damaging	1.00
R6717:Ttc28	UTSW	5	111285436	missense	probably benign
R6770:Ttc28	UTSW	5	111286140	missense	probably damaging	1.00
R6901:Ttc28	UTSW	5	111277025	missense	possibly damaging	0.88
R7038:Ttc28	UTSW	5	111266579	missense	probably benign	0.09
R7073:Ttc28	UTSW	5	111223416	missense	possibly damaging	0.96
R7101:Ttc28	UTSW	5	111085092	missense	probably damaging	1.00
R7135:Ttc28	UTSW	5	111280007	missense	probably damaging	1.00
R7350:Ttc28	UTSW	5	111226037	missense	probably damaging	0.97
R7454:Ttc28	UTSW	5	111285484	missense	probably benign	0.19
R7461:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7596:Ttc28	UTSW	5	111280124	missense	probably damaging	1.00
R7613:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7625:Ttc28	UTSW	5	111285219	missense	possibly damaging	0.65
R7648:Ttc28	UTSW	5	111183392	missense	possibly damaging	0.52
R7735:Ttc28	UTSW	5	111266678	splice site	probably null
R8030:Ttc28	UTSW	5	111286056	missense	possibly damaging	0.81
R8205:Ttc28	UTSW	5	111225730	missense	possibly damaging	0.95
R8246:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8247:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8269:Ttc28	UTSW	5	111277459	missense	probably benign	0.09
R8292:Ttc28	UTSW	5	111223257	missense	probably damaging	1.00
V8831:Ttc28	UTSW	5	111100712	missense	probably benign	0.11
Z1088:Ttc28	UTSW	5	111286315	missense	probably benign	0.00
Z1176:Ttc28	UTSW	5	111266566	missense	possibly damaging	0.59
Z1177:Ttc28	UTSW	5	111278586	missense	probably damaging	1.00
Z1177:Ttc28	UTSW	5	111285739	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GCTTCTGCACGTGTCATCAG -3'
(R):5'- TGGTGATGAACTAGGCACAGC -3'

Sequencing Primer
(F):5'- ACGTGTCATCAGAAGCTTGC -3'
(R):5'- GCCTCTTACCTGGAGTAGTAAGAC -3'

Posted On

2017-02-10