Incidental Mutation 'R0555:Syne4'
ID 45468
Institutional Source Beutler Lab
Gene Symbol Syne4
Ensembl Gene ENSMUSG00000019737
Gene Name spectrin repeat containing, nuclear envelope family member 4
Synonyms 0610012K07Rik, AI428936, nesprin-4
MMRRC Submission 038747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R0555 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30014268-30018471 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30016169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 195 (A195T)
Ref Sequence ENSEMBL: ENSMUSP00000135637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054594] [ENSMUST00000060834] [ENSMUST00000098585] [ENSMUST00000098586] [ENSMUST00000176504] [ENSMUST00000176304] [ENSMUST00000137550] [ENSMUST00000136887] [ENSMUST00000177078] [ENSMUST00000176789]
AlphaFold Q8CII8
Predicted Effect possibly damaging
Transcript: ENSMUST00000054594
AA Change: A195T

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055874
Gene: ENSMUSG00000019737
AA Change: A195T

DomainStartEndE-ValueType
Blast:SPEC 96 198 2e-34 BLAST
low complexity region 222 234 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
KASH 335 388 2.85e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060834
SMART Domains Protein: ENSMUSP00000051515
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 23 224 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098585
SMART Domains Protein: ENSMUSP00000096184
Gene: ENSMUSG00000074210

DomainStartEndE-ValueType
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098586
SMART Domains Protein: ENSMUSP00000096185
Gene: ENSMUSG00000074211

DomainStartEndE-ValueType
Pfam:Complex1_LYR 9 63 2.1e-16 PFAM
Pfam:Complex1_LYR_1 9 65 5.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135882
Predicted Effect possibly damaging
Transcript: ENSMUST00000176504
AA Change: A167T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135844
Gene: ENSMUSG00000019737
AA Change: A167T

DomainStartEndE-ValueType
Blast:SPEC 92 170 2e-33 BLAST
low complexity region 194 206 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176304
AA Change: A195T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135637
Gene: ENSMUSG00000019737
AA Change: A195T

DomainStartEndE-ValueType
Blast:SPEC 96 196 3e-34 BLAST
low complexity region 197 232 N/A INTRINSIC
KASH 252 305 2.85e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143369
Predicted Effect probably benign
Transcript: ENSMUST00000137550
Predicted Effect probably benign
Transcript: ENSMUST00000136887
SMART Domains Protein: ENSMUSP00000121953
Gene: ENSMUSG00000042831

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 3 210 2.1e-16 PFAM
Pfam:2OG-FeII_Oxy 82 213 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176232
Predicted Effect possibly damaging
Transcript: ENSMUST00000177078
AA Change: A147T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135895
Gene: ENSMUSG00000019737
AA Change: A147T

DomainStartEndE-ValueType
Blast:SPEC 88 150 4e-24 BLAST
low complexity region 174 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176965
Predicted Effect probably benign
Transcript: ENSMUST00000176789
Predicted Effect probably benign
Transcript: ENSMUST00000176571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177257
Meta Mutation Damage Score 0.1007 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss associated with outer hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,661,516 (GRCm39) I363N probably damaging Het
Ahcyl2 T C 6: 29,890,670 (GRCm39) probably benign Het
Asap1 A G 15: 63,966,213 (GRCm39) L941P probably damaging Het
Aurka G A 2: 172,209,067 (GRCm39) R23C probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 (GRCm39) H478Q probably damaging Het
Clcn4 C T 7: 7,293,503 (GRCm39) A418T possibly damaging Het
Cplx3 T C 9: 57,521,384 (GRCm39) T193A probably benign Het
Cpxm2 A T 7: 131,645,772 (GRCm39) Y715* probably null Het
Csmd1 T C 8: 16,235,287 (GRCm39) M1179V probably benign Het
Ddx21 A T 10: 62,423,307 (GRCm39) F632I probably damaging Het
Dnai1 C A 4: 41,625,335 (GRCm39) T433K possibly damaging Het
Dpyd G A 3: 119,225,191 (GRCm39) G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,044,862 (GRCm39) probably null Het
Dync1li2 A T 8: 105,147,297 (GRCm39) S466T probably benign Het
Ears2 T C 7: 121,647,667 (GRCm39) T206A probably benign Het
Elmod1 A T 9: 53,838,876 (GRCm39) probably benign Het
Eps8l3 C A 3: 107,799,661 (GRCm39) D590E probably benign Het
Etfdh A T 3: 79,513,112 (GRCm39) H370Q probably benign Het
Fam83g C A 11: 61,598,489 (GRCm39) A792E probably benign Het
Ffar3 G T 7: 30,554,962 (GRCm39) Y119* probably null Het
Fosb G T 7: 19,041,138 (GRCm39) S118R possibly damaging Het
Foxn4 G A 5: 114,401,175 (GRCm39) L3F probably damaging Het
Foxo4 A G X: 100,298,784 (GRCm39) K65E probably damaging Het
Frem2 A G 3: 53,424,281 (GRCm39) L3052P probably damaging Het
Fubp3 G A 2: 31,498,149 (GRCm39) R101H probably damaging Het
Gba2 C A 4: 43,569,927 (GRCm39) G429C probably damaging Het
Gimap1 T C 6: 48,718,363 (GRCm39) probably benign Het
Gnas A G 2: 174,140,304 (GRCm39) T158A possibly damaging Het
Gpc5 T C 14: 115,789,740 (GRCm39) V538A probably damaging Het
Greb1l T C 18: 10,458,781 (GRCm39) probably benign Het
H2-M10.5 G A 17: 37,085,620 (GRCm39) G260R probably damaging Het
Hbs1l A C 10: 21,225,222 (GRCm39) Q412H probably benign Het
Hecw1 G T 13: 14,411,526 (GRCm39) T1058N probably damaging Het
Heph A T X: 95,601,690 (GRCm39) T1027S probably damaging Het
Hoga1 A C 19: 42,034,514 (GRCm39) E53A possibly damaging Het
Insrr T G 3: 87,721,744 (GRCm39) probably benign Het
Ipo11 A T 13: 107,028,969 (GRCm39) V328D probably damaging Het
Jakmip1 T C 5: 37,276,217 (GRCm39) V509A probably damaging Het
Jmjd1c T C 10: 67,061,568 (GRCm39) V1307A probably benign Het
Kmt2a T A 9: 44,758,868 (GRCm39) S1027C probably damaging Het
Kprp G C 3: 92,731,664 (GRCm39) P462R unknown Het
Lrit3 A T 3: 129,584,945 (GRCm39) V271D probably damaging Het
Map4 T A 9: 109,808,171 (GRCm39) probably benign Het
Mark4 A C 7: 19,182,598 (GRCm39) probably benign Het
Mfsd14b A G 13: 65,226,259 (GRCm39) V142A probably benign Het
Mis18bp1 A T 12: 65,208,227 (GRCm39) I162N possibly damaging Het
Mrpl43 A T 19: 44,994,391 (GRCm39) probably benign Het
Mrpl47 A G 3: 32,790,842 (GRCm39) F16S probably benign Het
Myh2 G T 11: 67,069,793 (GRCm39) G380C probably damaging Het
Myo15a T C 11: 60,412,464 (GRCm39) Y3284H probably damaging Het
Nectin2 A G 7: 19,467,148 (GRCm39) probably benign Het
Neu3 A G 7: 99,463,390 (GRCm39) V111A probably damaging Het
Nol4l T C 2: 153,259,604 (GRCm39) probably null Het
Nphp3 C A 9: 103,900,633 (GRCm39) H510Q probably damaging Het
Nprl3 T A 11: 32,183,118 (GRCm39) probably null Het
Or14c39 A G 7: 86,344,516 (GRCm39) N284S probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or52ab7 T C 7: 102,978,170 (GRCm39) V159A probably benign Het
Or6c2 T C 10: 129,362,765 (GRCm39) I223T possibly damaging Het
Pex1 A G 5: 3,656,130 (GRCm39) E319G possibly damaging Het
Pgap6 T C 17: 26,336,088 (GRCm39) L130S probably benign Het
Phtf1 C A 3: 103,911,785 (GRCm39) T709K probably damaging Het
Plek2 A T 12: 78,938,946 (GRCm39) L271Q probably damaging Het
Plekhg5 T A 4: 152,191,926 (GRCm39) C421* probably null Het
Polk A C 13: 96,620,687 (GRCm39) C525W probably damaging Het
Ppfibp2 T C 7: 107,328,381 (GRCm39) S471P probably damaging Het
Prickle2 A T 6: 92,435,546 (GRCm39) F74L probably benign Het
Prl7d1 A T 13: 27,896,038 (GRCm39) V113D probably benign Het
Prr14 C T 7: 127,071,267 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ret A G 6: 118,155,571 (GRCm39) V375A probably damaging Het
Rora T C 9: 69,269,028 (GRCm39) F41S probably damaging Het
Sall1 T C 8: 89,758,386 (GRCm39) T573A probably benign Het
Shb A G 4: 45,458,321 (GRCm39) V281A possibly damaging Het
Slc25a26 A T 6: 94,569,391 (GRCm39) probably null Het
Sltm T C 9: 70,493,363 (GRCm39) F769L probably damaging Het
Snx9 T A 17: 5,968,688 (GRCm39) M328K probably damaging Het
Stk25 G T 1: 93,552,313 (GRCm39) Q356K probably benign Het
Svep1 T A 4: 58,128,858 (GRCm39) Y613F possibly damaging Het
Tmem217b A T 17: 29,738,545 (GRCm39) F74I probably benign Het
Trcg1 C T 9: 57,149,616 (GRCm39) T396M probably damaging Het
Trim30b A G 7: 104,006,505 (GRCm39) V117A possibly damaging Het
Trpc4 T C 3: 54,209,511 (GRCm39) probably benign Het
Ttll4 A G 1: 74,727,439 (GRCm39) H827R probably damaging Het
Tut7 A G 13: 59,948,131 (GRCm39) V328A probably benign Het
Urgcp T C 11: 5,667,477 (GRCm39) E287G probably damaging Het
Usp2 G T 9: 44,004,081 (GRCm39) L319F probably damaging Het
Vmn1r167 A T 7: 23,204,512 (GRCm39) V168D probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r61 A T 7: 41,915,442 (GRCm39) I130F probably benign Het
Vmn2r63 A T 7: 42,577,952 (GRCm39) Y195* probably null Het
Vmn2r81 T C 10: 79,129,283 (GRCm39) S725P probably damaging Het
Wnt10b A G 15: 98,670,818 (GRCm39) probably benign Het
Zfp292 T C 4: 34,807,194 (GRCm39) E1950G probably damaging Het
Zfyve16 A G 13: 92,653,028 (GRCm39) probably benign Het
Other mutations in Syne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Syne4 APN 7 30,015,988 (GRCm39) splice site probably null
IGL02386:Syne4 APN 7 30,015,659 (GRCm39) missense possibly damaging 0.91
R0089:Syne4 UTSW 7 30,018,344 (GRCm39) missense probably damaging 0.99
R0091:Syne4 UTSW 7 30,018,344 (GRCm39) missense probably damaging 0.99
R0448:Syne4 UTSW 7 30,014,345 (GRCm39) start gained probably benign
R1205:Syne4 UTSW 7 30,014,761 (GRCm39) missense probably damaging 0.96
R1862:Syne4 UTSW 7 30,016,308 (GRCm39) missense probably benign 0.06
R1863:Syne4 UTSW 7 30,016,308 (GRCm39) missense probably benign 0.06
R4776:Syne4 UTSW 7 30,016,258 (GRCm39) splice site probably benign
R5325:Syne4 UTSW 7 30,018,401 (GRCm39) missense probably damaging 1.00
R6145:Syne4 UTSW 7 30,015,988 (GRCm39) splice site probably null
R6479:Syne4 UTSW 7 30,016,340 (GRCm39) nonsense probably null
R7823:Syne4 UTSW 7 30,018,280 (GRCm39) missense probably benign 0.09
R9013:Syne4 UTSW 7 30,017,418 (GRCm39) missense probably damaging 1.00
R9541:Syne4 UTSW 7 30,016,343 (GRCm39) missense probably benign 0.02
R9596:Syne4 UTSW 7 30,014,504 (GRCm39) missense probably benign 0.01
Z1088:Syne4 UTSW 7 30,015,761 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGAGTGTCTAGCCATGTGTTCCAG -3'
(R):5'- CCTTGAAAGGGAAAGGCCATACCAG -3'

Sequencing Primer
(F):5'- ATGTGTTCCAGGCCCTGC -3'
(R):5'- GGGCTGATCTCACCTCAAG -3'
Posted On 2013-06-11