Mutagenetix > Incidental Mutations

Incidental Mutation 'R5851:Itga2b'

454687

Institutional Source

Beutler Lab

Gene Symbol

Itga2b

Ensembl Gene

ENSMUSG00000034664

Gene Name

integrin alpha 2b

Synonyms

platelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41

MMRRC Submission

044067-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R5851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102453297-102470122 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to A at 102457601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103086]

AlphaFold

Q9QUM0

Predicted Effect

probably benign
Transcript: ENSMUST00000103086

SMART Domains

Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Int_alpha	46	103	2.34e-10	SMART
Int_alpha	261	311	1.3e-3	SMART
Int_alpha	315	376	4.9e-13	SMART
Int_alpha	382	438	4.34e-14	SMART
Int_alpha	443	494	4.05e-5	SMART
low complexity region	552	567	N/A	INTRINSIC
SCOP:d1m1xa2	635	770	1e-48	SMART
SCOP:d1m1xa3	775	995	3e-66	SMART
Pfam:Integrin_alpha	1015	1029	5.7e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128752

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131247

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134735

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151625

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174900

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930404N11Rik	A	T	10: 81,364,877		probably null	Het
Abca2	A	G	2: 25,442,310	N1452D	possibly damaging	Het
Abhd15	T	C	11: 77,518,447	L329P	probably benign	Het
Add3	T	C	19: 53,236,774	S442P	probably damaging	Het
Arhgef18	T	C	8: 3,434,980	F228L	probably damaging	Het
Bptf	A	T	11: 107,110,862	Y475N	probably damaging	Het
C3	T	C	17: 57,211,612	N1257S	probably null	Het
Ccdc94	C	T	17: 55,967,582	S298F	probably damaging	Het
Cd163l1	C	T	7: 140,228,027	P704S	possibly damaging	Het
Cdkl1	A	T	12: 69,756,564	Y179*	probably null	Het
Ceacam1	T	C	7: 25,474,600	N210S	possibly damaging	Het
Celf3	T	A	3: 94,479,126	I7N	probably damaging	Het
Cmpk1	A	G	4: 114,986,970	V55A	possibly damaging	Het
Csrnp1	C	T	9: 119,973,078	G305D	possibly damaging	Het
Dnah3	A	G	7: 120,039,362	S1266P	possibly damaging	Het
Edc4	T	C	8: 105,890,867	L1077P	probably damaging	Het
Efcab1	T	A	16: 14,920,436	L155H	probably damaging	Het
Fam174a	G	A	1: 95,325,143	G157S	probably damaging	Het
Fubp3	T	A	2: 31,598,610	D159E	probably benign	Het
Garem2	C	T	5: 30,114,290	T250M	probably damaging	Het
H2-Eb1	C	T	17: 34,309,771	P92L	probably benign	Het
Ifnl3	G	T	7: 28,523,511	C69F	probably damaging	Het
Klhl33	A	T	14: 50,892,878	D386E	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lor	G	A	3: 92,080,539	A480V	unknown	Het
Msh3	G	T	13: 92,215,522	Q1041K	probably benign	Het
Myo1e	G	A	9: 70,383,804	G959E	probably benign	Het
Nfat5	G	T	8: 107,347,727	V338L	probably damaging	Het
Nrf1	A	G	6: 30,089,976	H18R	possibly damaging	Het
Nup160	A	G	2: 90,707,038	D752G	probably benign	Het
Obscn	A	T	11: 58,994,700	L2489*	probably null	Het
Olfr1184	A	G	2: 88,486,860	I43V	possibly damaging	Het
Olfr638	A	G	7: 104,003,452	E59G	probably benign	Het
Paip1	T	C	13: 119,440,765	S215P	possibly damaging	Het
Pate2	T	A	9: 35,670,501	Y26*	probably null	Het
Pcdhb10	A	G	18: 37,412,758	I296V	probably benign	Het
Pdzph1	T	G	17: 58,973,746	T514P	probably benign	Het
Pnlip	G	A	19: 58,673,792	W123*	probably null	Het
Prmt2	C	A	10: 76,236,740	C9F	possibly damaging	Het
Rbl1	T	A	2: 157,167,325	K763N	probably benign	Het
Rfk	C	T	19: 17,395,198	A28V	probably damaging	Het
Sdk1	G	A	5: 141,962,669	V590I	probably benign	Het
Sele	A	G	1: 164,049,574	K140E	probably benign	Het
Skiv2l2	G	A	13: 112,908,952	R349W	probably damaging	Het
Sla	G	A	15: 66,783,723	T189I	probably damaging	Het
Slc46a2	A	G	4: 59,913,906	V339A	probably damaging	Het
Slc5a9	A	G	4: 111,885,600	F432L	probably benign	Het
Slc6a19	A	G	13: 73,691,740	F141S	possibly damaging	Het
Tas2r123	T	C	6: 132,847,308	L56S	probably damaging	Het
Tmem245	T	C	4: 56,916,770	I53V	probably benign	Het
Tor2a	A	T	2: 32,761,607	Q278L	probably benign	Het
Trav6-3	A	G	14: 53,430,115	M15V	probably benign	Het
Ttc28	G	A	5: 111,235,469		probably benign	Het
Ubap2	G	A	4: 41,206,268	Q534*	probably null	Het
Zfp954	C	A	7: 7,115,625	E307*	probably null	Het
Zscan21	A	G	5: 138,126,478	K219E	probably benign	Het

Other mutations in Itga2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Itga2b	APN	11	102455583	missense	probably damaging	1.00
IGL02197:Itga2b	APN	11	102466319	missense	probably benign	0.19
IGL02349:Itga2b	APN	11	102461363	missense	probably damaging	0.98
IGL02711:Itga2b	APN	11	102465725	missense	possibly damaging	0.53
R0282:Itga2b	UTSW	11	102460846	missense	probably damaging	0.99
R0349:Itga2b	UTSW	11	102467426	missense	probably damaging	0.98
R0384:Itga2b	UTSW	11	102465362	splice site	probably null
R0403:Itga2b	UTSW	11	102467326	critical splice donor site	probably null
R0452:Itga2b	UTSW	11	102465953	splice site	probably null
R0535:Itga2b	UTSW	11	102457533	missense	possibly damaging	0.65
R1412:Itga2b	UTSW	11	102457005	missense	probably benign	0.00
R1517:Itga2b	UTSW	11	102466325	nonsense	probably null
R1615:Itga2b	UTSW	11	102460137	critical splice donor site	probably null
R1716:Itga2b	UTSW	11	102460777	missense	probably benign	0.30
R1953:Itga2b	UTSW	11	102458183	missense	probably benign	0.18
R2001:Itga2b	UTSW	11	102467339	missense	probably benign
R2216:Itga2b	UTSW	11	102467866	missense	probably benign	0.35
R4193:Itga2b	UTSW	11	102469685	missense	probably benign	0.01
R4770:Itga2b	UTSW	11	102460756	missense	probably damaging	1.00
R4805:Itga2b	UTSW	11	102467866	missense	probably benign	0.00
R4880:Itga2b	UTSW	11	102457722	intron	probably benign
R4906:Itga2b	UTSW	11	102461159	missense	probably benign	0.43
R5112:Itga2b	UTSW	11	102458191	missense	probably damaging	0.99
R5362:Itga2b	UTSW	11	102461135	missense	probably damaging	0.99
R5739:Itga2b	UTSW	11	102465909	missense	probably benign	0.14
R5761:Itga2b	UTSW	11	102466274	missense	probably benign	0.00
R5840:Itga2b	UTSW	11	102461331	missense	probably damaging	1.00
R6239:Itga2b	UTSW	11	102465318	missense	possibly damaging	0.61
R6491:Itga2b	UTSW	11	102459869	splice site	probably null
R7426:Itga2b	UTSW	11	102456294	missense	probably benign	0.01
R7635:Itga2b	UTSW	11	102461756	missense	probably damaging	1.00
R7664:Itga2b	UTSW	11	102460840	missense	probably damaging	1.00
R7832:Itga2b	UTSW	11	102457282	missense	probably damaging	0.98
R8120:Itga2b	UTSW	11	102469542	missense	probably damaging	0.98
R8254:Itga2b	UTSW	11	102467386	missense	probably benign	0.16
R8296:Itga2b	UTSW	11	102461159	missense	possibly damaging	0.79
R8362:Itga2b	UTSW	11	102461363	missense	probably damaging	1.00
R8815:Itga2b	UTSW	11	102460861	missense	possibly damaging	0.91
R8901:Itga2b	UTSW	11	102460804	missense	probably damaging	0.99
R9277:Itga2b	UTSW	11	102461156	missense	probably damaging	1.00
R9335:Itga2b	UTSW	11	102455652	missense	probably damaging	0.99
Z1177:Itga2b	UTSW	11	102467076	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCTTACCCAGAGGCTCCTC -3'
(R):5'- CAAACAGTAAGGTCGTGATGTTG -3'

Sequencing Primer
(F):5'- AGAGGCTCCTCCCTACCTCATAG -3'
(R):5'- CCTGTGGCAATCCAAGCTGAAG -3'

Posted On

2017-02-10