Incidental Mutation 'R5851:Itga2b'
ID454687
Institutional Source Beutler Lab
Gene Symbol Itga2b
Ensembl Gene ENSMUSG00000034664
Gene Nameintegrin alpha 2b
Synonymsplatelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R5851 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102453297-102470122 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 102457601 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103086]
Predicted Effect probably benign
Transcript: ENSMUST00000103086
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174900
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Celf3 T A 3: 94,479,126 I7N probably damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lor G A 3: 92,080,539 A480V unknown Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Myo1e G A 9: 70,383,804 G959E probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Pnlip G A 19: 58,673,792 W123* probably null Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc5a9 A G 4: 111,885,600 F432L probably benign Het
Slc6a19 A G 13: 73,691,740 F141S possibly damaging Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tmem245 T C 4: 56,916,770 I53V probably benign Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Itga2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Itga2b APN 11 102455583 missense probably damaging 1.00
IGL02197:Itga2b APN 11 102466319 missense probably benign 0.19
IGL02349:Itga2b APN 11 102461363 missense probably damaging 0.98
IGL02711:Itga2b APN 11 102465725 missense possibly damaging 0.53
R0282:Itga2b UTSW 11 102460846 missense probably damaging 0.99
R0349:Itga2b UTSW 11 102467426 missense probably damaging 0.98
R0384:Itga2b UTSW 11 102465362 splice site probably null
R0403:Itga2b UTSW 11 102467326 critical splice donor site probably null
R0452:Itga2b UTSW 11 102465953 intron probably null
R0535:Itga2b UTSW 11 102457533 missense possibly damaging 0.65
R1412:Itga2b UTSW 11 102457005 missense probably benign 0.00
R1517:Itga2b UTSW 11 102466325 nonsense probably null
R1615:Itga2b UTSW 11 102460137 critical splice donor site probably null
R1716:Itga2b UTSW 11 102460777 missense probably benign 0.30
R1953:Itga2b UTSW 11 102458183 missense probably benign 0.18
R2001:Itga2b UTSW 11 102467339 missense probably benign
R2216:Itga2b UTSW 11 102467866 missense probably benign 0.35
R4193:Itga2b UTSW 11 102469685 missense probably benign 0.01
R4770:Itga2b UTSW 11 102460756 missense probably damaging 1.00
R4805:Itga2b UTSW 11 102467866 missense probably benign 0.00
R4880:Itga2b UTSW 11 102457722 intron probably benign
R4906:Itga2b UTSW 11 102461159 missense probably benign 0.43
R5112:Itga2b UTSW 11 102458191 missense probably damaging 0.99
R5362:Itga2b UTSW 11 102461135 missense probably damaging 0.99
R5739:Itga2b UTSW 11 102465909 missense probably benign 0.14
R5761:Itga2b UTSW 11 102466274 missense probably benign 0.00
R5840:Itga2b UTSW 11 102461331 missense probably damaging 1.00
R6239:Itga2b UTSW 11 102465318 missense possibly damaging 0.61
R6491:Itga2b UTSW 11 102459869 splice site probably null
R7426:Itga2b UTSW 11 102456294 missense probably benign 0.01
R7635:Itga2b UTSW 11 102461756 missense probably damaging 1.00
R7664:Itga2b UTSW 11 102460840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTACCCAGAGGCTCCTC -3'
(R):5'- CAAACAGTAAGGTCGTGATGTTG -3'

Sequencing Primer
(F):5'- AGAGGCTCCTCCCTACCTCATAG -3'
(R):5'- CCTGTGGCAATCCAAGCTGAAG -3'
Posted On2017-02-10