Incidental Mutation 'R5851:Pnlip'
ID454704
Institutional Source Beutler Lab
Gene Symbol Pnlip
Ensembl Gene ENSMUSG00000046008
Gene Namepancreatic lipase
Synonymspancreatic triglyceride lipase, PTL, 1810007A24Rik
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5851 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location58670365-58681786 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 58673792 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 123 (W123*)
Ref Sequence ENSEMBL: ENSMUSP00000056377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057270]
Predicted Effect probably null
Transcript: ENSMUST00000057270
AA Change: W123*
SMART Domains Protein: ENSMUSP00000056377
Gene: ENSMUSG00000046008
AA Change: W123*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipase 17 352 2.4e-164 PFAM
LH2 355 465 4.47e-25 SMART
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipase family of proteins. The encoded enzyme is secreted by the pancreas and hydrolyzes triglycerides in the small intestine, and is essential for the efficient digestion of dietary fats. Inhibition of the encoded enzyme may prevent high-fat diet-induced obesity in mice and result in weight loss in human patients with obesity. Mutations in this gene cause congenital pancreatic lipase deficiency, a rare disorder characterized by steatorrhea. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice show impaired dietary cholesterol, triglyceride and retinyl ester absorption, resistance to diet-induced obesity, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Celf3 T A 3: 94,479,126 I7N probably damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Itga2b C A 11: 102,457,601 probably benign Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lor G A 3: 92,080,539 A480V unknown Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Myo1e G A 9: 70,383,804 G959E probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc5a9 A G 4: 111,885,600 F432L probably benign Het
Slc6a19 A G 13: 73,691,740 F141S possibly damaging Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tmem245 T C 4: 56,916,770 I53V probably benign Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Pnlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Pnlip APN 19 58673874 missense probably benign 0.00
IGL02733:Pnlip APN 19 58680788 missense probably benign
R1121:Pnlip UTSW 19 58680908 splice site probably null
R2145:Pnlip UTSW 19 58676444 missense probably benign 0.11
R2213:Pnlip UTSW 19 58673770 missense probably benign 0.07
R3405:Pnlip UTSW 19 58680759 missense probably benign
R4703:Pnlip UTSW 19 58676467 missense probably damaging 1.00
R4731:Pnlip UTSW 19 58676487 missense probably benign 0.00
R4909:Pnlip UTSW 19 58676240 missense possibly damaging 0.85
R5386:Pnlip UTSW 19 58679607 missense probably benign 0.25
R5444:Pnlip UTSW 19 58673163 missense probably benign 0.00
R6515:Pnlip UTSW 19 58673115 missense probably damaging 1.00
R6605:Pnlip UTSW 19 58671742 missense probably benign 0.20
R6974:Pnlip UTSW 19 58679635 critical splice donor site probably null
R7057:Pnlip UTSW 19 58676263 missense probably damaging 1.00
R7312:Pnlip UTSW 19 58681702 missense probably damaging 0.97
R7358:Pnlip UTSW 19 58676544 missense probably damaging 1.00
R7476:Pnlip UTSW 19 58679634 critical splice donor site probably null
R7674:Pnlip UTSW 19 58675154 missense possibly damaging 0.70
R7800:Pnlip UTSW 19 58681702 missense probably benign 0.18
R7983:Pnlip UTSW 19 58680059 missense probably benign 0.04
X0025:Pnlip UTSW 19 58680810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCATAGCATTGGGGTTAACAC -3'
(R):5'- CAAGATTGGGGTGGGATTCATC -3'

Sequencing Primer
(F):5'- TCATAGCATTGGGGTTAACACGATAG -3'
(R):5'- TGGGATTCATCTTTAAGCAAAAGGG -3'
Posted On2017-02-10