Incidental Mutation 'R5852:Fam189a1'
ID 454719
Institutional Source Beutler Lab
Gene Symbol Fam189a1
Ensembl Gene ENSMUSG00000030518
Gene Name family with sequence similarity 189, member A1
Synonyms
MMRRC Submission 043227-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5852 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 64756091-65156570 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64775831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 171 (H171L)
Ref Sequence ENSEMBL: ENSMUSP00000115095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119118] [ENSMUST00000149851]
AlphaFold Q6A044
Predicted Effect probably damaging
Transcript: ENSMUST00000119118
AA Change: H267L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113680
Gene: ENSMUSG00000030518
AA Change: H267L

DomainStartEndE-ValueType
Pfam:CD20 34 199 4.9e-33 PFAM
low complexity region 243 259 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133883
Predicted Effect probably damaging
Transcript: ENSMUST00000149851
AA Change: H171L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115095
Gene: ENSMUSG00000030518
AA Change: H171L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,927,404 I453F probably damaging Het
Anpep C T 7: 79,838,972 W402* probably null Het
Apcdd1 T C 18: 62,937,063 S134P probably damaging Het
Cbwd1 A G 19: 24,955,405 V88A possibly damaging Het
Ccdc154 T C 17: 25,163,209 V34A probably benign Het
Cntn3 A T 6: 102,420,416 N65K probably damaging Het
Cntn6 G T 6: 104,835,745 V663F probably damaging Het
Crisp3 A T 17: 40,225,820 C201* probably null Het
Dnhd1 T A 7: 105,695,748 W2100R probably damaging Het
Dync2h1 A T 9: 7,011,290 S3634R probably benign Het
Gucy1a2 T C 9: 3,865,460 F645L probably damaging Het
Hs6st3 G T 14: 119,869,326 R382L probably damaging Het
Il27 T A 7: 126,592,614 T89S possibly damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Klhl23 T A 2: 69,824,269 I161N probably benign Het
Lrrk2 G A 15: 91,755,949 E1566K probably damaging Het
Mia3 A G 1: 183,332,859 V437A probably benign Het
Ncoa6 G T 2: 155,405,499 H1962N possibly damaging Het
Nox4 C T 7: 87,338,964 T361I probably damaging Het
Pappa2 T C 1: 158,717,014 Y1748C probably damaging Het
Phyhip T C 14: 70,461,929 probably null Het
Pkhd1 A G 1: 20,377,408 F2254L probably benign Het
Plxnb1 A G 9: 109,106,450 Y1018C probably damaging Het
Pnoc C T 14: 65,411,222 V8I probably benign Het
Prss29 A G 17: 25,322,434 D256G probably benign Het
Scrn3 T C 2: 73,331,005 F312L probably damaging Het
Sephs1 A G 2: 4,899,528 E239G possibly damaging Het
Tti1 A G 2: 158,000,673 L812P probably damaging Het
Wdr1 A G 5: 38,537,175 S62P probably benign Het
Zfp106 A G 2: 120,516,006 S1659P probably damaging Het
Other mutations in Fam189a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fam189a1 APN 7 64819842 missense probably damaging 1.00
IGL02567:Fam189a1 APN 7 64786731 missense possibly damaging 0.95
thick UTSW 7 64759368 nonsense probably null
R0612:Fam189a1 UTSW 7 64761801 missense probably benign 0.17
R0720:Fam189a1 UTSW 7 64819910 splice site probably benign
R1368:Fam189a1 UTSW 7 64819877 missense probably damaging 1.00
R1716:Fam189a1 UTSW 7 64776885 splice site probably null
R1840:Fam189a1 UTSW 7 64759195 missense probably benign 0.37
R1972:Fam189a1 UTSW 7 64775768 missense possibly damaging 0.91
R1973:Fam189a1 UTSW 7 64775768 missense possibly damaging 0.91
R2201:Fam189a1 UTSW 7 64759393 missense probably benign 0.01
R2230:Fam189a1 UTSW 7 64759222 missense probably damaging 0.97
R2232:Fam189a1 UTSW 7 64759222 missense probably damaging 0.97
R2340:Fam189a1 UTSW 7 64775817 missense probably benign 0.00
R4809:Fam189a1 UTSW 7 64776740 missense probably damaging 1.00
R4923:Fam189a1 UTSW 7 64767691 missense probably benign 0.00
R4928:Fam189a1 UTSW 7 64759368 nonsense probably null
R5556:Fam189a1 UTSW 7 64856209 missense probably damaging 1.00
R6169:Fam189a1 UTSW 7 64759399 missense probably benign 0.00
R7029:Fam189a1 UTSW 7 64759327 missense probably benign 0.00
R7455:Fam189a1 UTSW 7 64759413 missense probably benign 0.00
R7512:Fam189a1 UTSW 7 65156170 missense probably benign 0.23
R7896:Fam189a1 UTSW 7 64776809 missense probably damaging 1.00
R8166:Fam189a1 UTSW 7 64759405 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCTGAGAGAGGAGCCTTC -3'
(R):5'- GTCATCTCAGGCATGGTGTTC -3'

Sequencing Primer
(F):5'- AGCCTTCTAAGGGCAGGC -3'
(R):5'- GGTGTTCCATCCTGAAGGG -3'
Posted On 2017-02-10