Mutagenetix > Incidental Mutations

Incidental Mutation 'R5852:Apcdd1'

454738

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

043227-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R5852 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62937063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 134 (S134P)

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably damaging
Transcript: ENSMUST00000096554
AA Change: S134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: S134P

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163716
AA Change: S134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: S134P

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,927,404	I453F	probably damaging	Het
Anpep	C	T	7: 79,838,972	W402*	probably null	Het
Cbwd1	A	G	19: 24,955,405	V88A	possibly damaging	Het
Ccdc154	T	C	17: 25,163,209	V34A	probably benign	Het
Cntn3	A	T	6: 102,420,416	N65K	probably damaging	Het
Cntn6	G	T	6: 104,835,745	V663F	probably damaging	Het
Crisp3	A	T	17: 40,225,820	C201*	probably null	Het
Dnhd1	T	A	7: 105,695,748	W2100R	probably damaging	Het
Dync2h1	A	T	9: 7,011,290	S3634R	probably benign	Het
Fam189a1	T	A	7: 64,775,831	H171L	probably damaging	Het
Gucy1a2	T	C	9: 3,865,460	F645L	probably damaging	Het
Hs6st3	G	T	14: 119,869,326	R382L	probably damaging	Het
Il27	T	A	7: 126,592,614	T89S	possibly damaging	Het
Iqgap2	C	T	13: 95,675,372	R707H	probably damaging	Het
Klhl23	T	A	2: 69,824,269	I161N	probably benign	Het
Lrrk2	G	A	15: 91,755,949	E1566K	probably damaging	Het
Mia3	A	G	1: 183,332,859	V437A	probably benign	Het
Ncoa6	G	T	2: 155,405,499	H1962N	possibly damaging	Het
Nox4	C	T	7: 87,338,964	T361I	probably damaging	Het
Pappa2	T	C	1: 158,717,014	Y1748C	probably damaging	Het
Phyhip	T	C	14: 70,461,929		probably null	Het
Pkhd1	A	G	1: 20,377,408	F2254L	probably benign	Het
Plxnb1	A	G	9: 109,106,450	Y1018C	probably damaging	Het
Pnoc	C	T	14: 65,411,222	V8I	probably benign	Het
Prss29	A	G	17: 25,322,434	D256G	probably benign	Het
Scrn3	T	C	2: 73,331,005	F312L	probably damaging	Het
Sephs1	A	G	2: 4,899,528	E239G	possibly damaging	Het
Tti1	A	G	2: 158,000,673	L812P	probably damaging	Het
Wdr1	A	G	5: 38,537,175	S62P	probably benign	Het
Zfp106	A	G	2: 120,516,006	S1659P	probably damaging	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACACGCTGTTGGCTTTATC -3'
(R):5'- TGGTGCACTCGTGGTTACTC -3'

Sequencing Primer
(F):5'- ACGCTGTTGGCTTTATCTAGCTC -3'
(R):5'- GGTTACTCTCCTCCTGCCACAG -3'

Posted On

2017-02-10