Incidental Mutation 'R5853:Lhx2'
ID454745
Institutional Source Beutler Lab
Gene Symbol Lhx2
Ensembl Gene ENSMUSG00000000247
Gene NameLIM homeobox protein 2
SynonymsLH2A, Lh-2, ap, apterous
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location38339281-38369733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38369041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000000253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000253] [ENSMUST00000143783]
Predicted Effect probably damaging
Transcript: ENSMUST00000000253
AA Change: V378A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000253
Gene: ENSMUSG00000000247
AA Change: V378A

DomainStartEndE-ValueType
LIM 52 105 6e-18 SMART
LIM 114 168 1.18e-16 SMART
low complexity region 187 206 N/A INTRINSIC
HOX 266 328 8.07e-22 SMART
low complexity region 357 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143783
AA Change: V337A

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114797
Gene: ENSMUSG00000000247
AA Change: V337A

DomainStartEndE-ValueType
LIM 11 64 6e-18 SMART
LIM 73 127 1.18e-16 SMART
low complexity region 146 165 N/A INTRINSIC
HOX 225 287 8.07e-22 SMART
low complexity region 316 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator. The protein can recapitulate or rescue phenotypes in Drosophila caused by a related protein, suggesting conservation of function during evolution. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during fetal development and the perinatal period with abnormal liver, telencephalon, olfactory bulb, basal ganglion, and eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Lhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02087:Lhx2 APN 2 38368837 splice site probably benign
IGL02243:Lhx2 APN 2 38353519 splice site probably benign
IGL02250:Lhx2 APN 2 38354833 missense probably benign 0.00
IGL03306:Lhx2 APN 2 38354616 missense probably damaging 1.00
R3700:Lhx2 UTSW 2 38360099 missense probably damaging 1.00
R3795:Lhx2 UTSW 2 38353347 missense probably damaging 1.00
R4650:Lhx2 UTSW 2 38360040 missense probably damaging 1.00
R4732:Lhx2 UTSW 2 38359991 missense probably damaging 1.00
R4733:Lhx2 UTSW 2 38359991 missense probably damaging 1.00
R7463:Lhx2 UTSW 2 38351846 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCTGGTTTCAGAATGCCCGG -3'
(R):5'- TCCTAAAACGTGGTTAGTTAGTTGC -3'

Sequencing Primer
(F):5'- AATGCCCGGGCCAAGTTC -3'
(R):5'- ACGTGGTTAGTTAGTTGCTCAAACC -3'
Posted On2017-02-10