Incidental Mutation 'R5853:Pabpc1l'
ID454749
Institutional Source Beutler Lab
Gene Symbol Pabpc1l
Ensembl Gene ENSMUSG00000054582
Gene Namepoly(A) binding protein, cytoplasmic 1-like
Synonyms1810053B01Rik, ePAB
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164025450-164050538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164049518 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 552 (H552L)
Ref Sequence ENSEMBL: ENSMUSP00000096701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018466] [ENSMUST00000067715] [ENSMUST00000109384]
Predicted Effect probably benign
Transcript: ENSMUST00000018466
SMART Domains Protein: ENSMUSP00000018466
Gene: ENSMUSG00000018322

DomainStartEndE-ValueType
TPR 9 42 1.4e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067715
AA Change: H552L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096701
Gene: ENSMUSG00000054582
AA Change: H552L

DomainStartEndE-ValueType
RRM 12 85 2.3e-23 SMART
RRM 100 171 1.84e-22 SMART
RRM 192 264 2.31e-28 SMART
RRM 295 366 7.07e-24 SMART
SCOP:d1g9la_ 425 478 1e-6 SMART
PolyA 535 598 8.33e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109384
SMART Domains Protein: ENSMUSP00000105010
Gene: ENSMUSG00000018322

DomainStartEndE-ValueType
TPR 9 42 1.73e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150523
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired oocyte maturation and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Pabpc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Pabpc1l APN 2 164042317 missense probably damaging 1.00
IGL00911:Pabpc1l APN 2 164042423 missense probably damaging 1.00
IGL02096:Pabpc1l APN 2 164044347 missense probably benign 0.00
IGL02198:Pabpc1l APN 2 164027616 missense probably damaging 0.97
IGL02534:Pabpc1l APN 2 164027490 missense probably damaging 1.00
IGL02684:Pabpc1l APN 2 164031277 missense probably benign
R0371:Pabpc1l UTSW 2 164035272 missense probably benign 0.08
R0799:Pabpc1l UTSW 2 164031214 missense probably benign
R1202:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1203:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1548:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1549:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1687:Pabpc1l UTSW 2 164044306 missense probably benign 0.00
R1928:Pabpc1l UTSW 2 164032254 missense possibly damaging 0.70
R2698:Pabpc1l UTSW 2 164044382 critical splice donor site probably null
R3925:Pabpc1l UTSW 2 164027676 splice site probably benign
R3944:Pabpc1l UTSW 2 164042327 missense probably damaging 1.00
R4052:Pabpc1l UTSW 2 164043613 missense probably benign 0.20
R4793:Pabpc1l UTSW 2 164027622 missense possibly damaging 0.94
R5001:Pabpc1l UTSW 2 164042518 missense probably benign 0.00
R5104:Pabpc1l UTSW 2 164043587 missense probably benign 0.00
R5456:Pabpc1l UTSW 2 164027660 missense probably damaging 1.00
R5569:Pabpc1l UTSW 2 164043554 missense probably benign 0.00
R5857:Pabpc1l UTSW 2 164044255 splice site probably null
R7107:Pabpc1l UTSW 2 164042479 missense probably damaging 0.99
R7650:Pabpc1l UTSW 2 164049590 missense probably benign 0.28
R8330:Pabpc1l UTSW 2 164027648 missense probably damaging 1.00
R8336:Pabpc1l UTSW 2 164032284 missense probably benign 0.07
T0722:Pabpc1l UTSW 2 164042420 missense possibly damaging 0.89
Z1088:Pabpc1l UTSW 2 164032324 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAAGGTGGTGCTGCTATGCC -3'
(R):5'- AGCAGATTGATGTCAGCTGC -3'

Sequencing Primer
(F):5'- GGTGCTGCTATGCCTACTTTATAAAG -3'
(R):5'- AGATTGATGTCAGCTGCCCTATC -3'
Posted On2017-02-10