Incidental Mutation 'R5853:Iqub'
ID454758
Institutional Source Beutler Lab
Gene Symbol Iqub
Ensembl Gene ENSMUSG00000046192
Gene NameIQ motif and ubiquitin domain containing
Synonyms4932408B21Rik, Trs4
MMRRC Submission 044068-MU
Accession Numbers

Genbank: NM_172535; MGI: 3041159

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24444865-24515067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24491602 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 362 (K362E)
Ref Sequence ENSEMBL: ENSMUSP00000051177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052277]
Predicted Effect probably benign
Transcript: ENSMUST00000052277
AA Change: K362E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000051177
Gene: ENSMUSG00000046192
AA Change: K362E

DomainStartEndE-ValueType
PDB:2DAF|A 119 216 1e-38 PDB
Blast:UBQ 129 199 3e-26 BLAST
low complexity region 218 229 N/A INTRINSIC
low complexity region 289 306 N/A INTRINSIC
IQ 333 355 1.74e-1 SMART
low complexity region 357 383 N/A INTRINSIC
low complexity region 735 742 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Iqub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Iqub APN 6 24501006 splice site probably benign
IGL01447:Iqub APN 6 24505628 missense probably benign 0.01
IGL01621:Iqub APN 6 24446212 missense probably benign 0.45
IGL01702:Iqub APN 6 24500313 missense probably benign 0.13
IGL01917:Iqub APN 6 24479319 missense probably damaging 0.97
IGL02411:Iqub APN 6 24449811 missense probably damaging 0.98
IGL02580:Iqub APN 6 24501399 missense probably benign 0.06
IGL02704:Iqub APN 6 24505910 splice site probably benign
IGL02901:Iqub APN 6 24454195 missense probably damaging 1.00
D4043:Iqub UTSW 6 24505751 missense possibly damaging 0.81
R0304:Iqub UTSW 6 24454291 missense probably damaging 0.99
R0391:Iqub UTSW 6 24446155 missense probably benign 0.00
R0453:Iqub UTSW 6 24450830 missense probably damaging 1.00
R0464:Iqub UTSW 6 24479263 nonsense probably null
R0465:Iqub UTSW 6 24503784 missense probably damaging 1.00
R0479:Iqub UTSW 6 24505810 missense probably benign 0.28
R0606:Iqub UTSW 6 24501261 splice site probably benign
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1238:Iqub UTSW 6 24505885 missense probably benign 0.03
R1452:Iqub UTSW 6 24491559 missense probably benign 0.13
R1927:Iqub UTSW 6 24491671 missense probably benign 0.11
R3195:Iqub UTSW 6 24462037 splice site probably benign
R4438:Iqub UTSW 6 24505868 missense probably benign 0.01
R4577:Iqub UTSW 6 24501291 missense probably damaging 0.99
R4671:Iqub UTSW 6 24479184 missense probably benign 0.00
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4906:Iqub UTSW 6 24501369 missense probably damaging 0.99
R5605:Iqub UTSW 6 24505621 missense probably benign
R5772:Iqub UTSW 6 24454251 missense possibly damaging 0.64
R5801:Iqub UTSW 6 24449769 missense probably benign 0.11
R6423:Iqub UTSW 6 24491529 missense probably damaging 0.98
R6475:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6476:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6477:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6701:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6702:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6703:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6860:Iqub UTSW 6 24505738 missense possibly damaging 0.81
R7331:Iqub UTSW 6 24500394 missense possibly damaging 0.73
R7530:Iqub UTSW 6 24450623 missense probably benign 0.00
R7997:Iqub UTSW 6 24501414 missense possibly damaging 0.86
R8050:Iqub UTSW 6 24503785 missense possibly damaging 0.95
X0025:Iqub UTSW 6 24500384 missense probably damaging 0.96
Z1088:Iqub UTSW 6 24500243 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGATCCCTACAACAACAGTGTCTTTC -3'
(R):5'- TTCAGACTAATTTCCTAAGTTCGGC -3'

Sequencing Primer
(F):5'- TCCCCATGAAGCCTGCTTGAG -3'
(R):5'- ACTAATTTCCTAAGTTCGGCGGGTC -3'
Posted On2017-02-10