Incidental Mutation 'R5853:Cd209b'
ID454765
Institutional Source Beutler Lab
Gene Symbol Cd209b
Ensembl Gene ENSMUSG00000065987
Gene NameCD209b antigen
Synonyms1810030I22Rik, SIGNR1, mSIGNR1
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3917655-3926844 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 3926549 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084086] [ENSMUST00000084086] [ENSMUST00000111014] [ENSMUST00000111014] [ENSMUST00000171635] [ENSMUST00000171635] [ENSMUST00000171635] [ENSMUST00000171635] [ENSMUST00000188386] [ENSMUST00000188386] [ENSMUST00000188386] [ENSMUST00000188386]
Predicted Effect probably null
Transcript: ENSMUST00000084086
SMART Domains Protein: ENSMUSP00000081104
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
CLECT 195 316 3.63e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084086
SMART Domains Protein: ENSMUSP00000081104
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
CLECT 195 316 3.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111014
SMART Domains Protein: ENSMUSP00000106643
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111014
SMART Domains Protein: ENSMUSP00000106643
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171635
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171635
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171635
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171635
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188386
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188386
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188386
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188386
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are more susceptible to S. pneumoniae infection and fail to clear the bacteria from the circulation. Marginal zone and peritoneal macrophages are impaired in recognizing the bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Cd209b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cd209b APN 8 3919945 splice site probably benign
IGL01596:Cd209b APN 8 3918744 missense probably damaging 1.00
IGL03211:Cd209b APN 8 3918830 splice site probably benign
R1434:Cd209b UTSW 8 3923367 missense possibly damaging 0.49
R4127:Cd209b UTSW 8 3918714 missense probably damaging 1.00
R4387:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4388:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4389:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4708:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4710:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4911:Cd209b UTSW 8 3926640 critical splice acceptor site probably null
R5454:Cd209b UTSW 8 3925396 missense probably damaging 0.98
R5814:Cd209b UTSW 8 3923348 missense probably damaging 0.99
R5867:Cd209b UTSW 8 3924246 missense possibly damaging 0.62
R5996:Cd209b UTSW 8 3918688 missense probably benign 0.39
R7020:Cd209b UTSW 8 3918783 missense probably damaging 0.99
R7187:Cd209b UTSW 8 3926638 missense probably benign
R7695:Cd209b UTSW 8 3926005 missense probably benign
R7712:Cd209b UTSW 8 3923299 missense possibly damaging 0.83
R7975:Cd209b UTSW 8 3925948 missense probably benign 0.41
R8309:Cd209b UTSW 8 3926559 nonsense probably null
R8317:Cd209b UTSW 8 3922018 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAACCTGTGATGTCTCCCCTAG -3'
(R):5'- AGAAGCCAAGATGCAGCCTC -3'

Sequencing Primer
(F):5'- GTGATGTCTCCCCTAGCCATC -3'
(R):5'- AAGATGCAGCCTCTTAGCTC -3'
Posted On2017-02-10