Mutagenetix > Incidental Mutation

Incidental Mutation 'R5853:Psme4'

454775

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

044068-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5853 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 30791234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably null
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000154757

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	G	A	7: 120,340,583	V303I	probably benign	Het
Abca4	G	T	3: 122,103,531	V620L	probably benign	Het
Ankk1	A	T	9: 49,418,695	V320E	possibly damaging	Het
Aoah	G	T	13: 20,999,902	A379S	probably benign	Het
Apol7e	A	G	15: 77,714,467	D44G	probably benign	Het
Atf2	T	C	2: 73,828,469		probably null	Het
Cd209b	T	C	8: 3,926,549		probably null	Het
Chek1	G	A	9: 36,713,687	S366L	probably damaging	Het
Chpf2	T	C	5: 24,592,192	L712P	probably damaging	Het
Clmn	C	A	12: 104,783,902		probably null	Het
Cnksr3	T	C	10: 7,142,977	D178G	probably benign	Het
Cpox	T	C	16: 58,675,417	Y366H	probably damaging	Het
Dnah3	A	G	7: 119,938,833	F3632S	probably damaging	Het
Eif5b	T	A	1: 38,037,307	D645E	probably damaging	Het
Emilin1	G	A	5: 30,918,622	E736K	probably damaging	Het
Gcnt4	G	A	13: 96,946,652	R152Q	probably benign	Het
Il6st	T	C	13: 112,481,537	S162P	probably damaging	Het
Iqub	T	C	6: 24,491,602	K362E	probably benign	Het
Kif22	G	T	7: 127,033,367	P257Q	possibly damaging	Het
Lhx2	T	C	2: 38,369,041	V378A	probably damaging	Het
Lipo1	A	G	19: 33,782,230	V202A	probably benign	Het
Lrp1b	T	A	2: 40,663,726	N366I	unknown	Het
Mbip	T	C	12: 56,335,877	D268G	probably damaging	Het
Mc5r	A	G	18: 68,339,493	M308V	probably benign	Het
Mndal	C	A	1: 173,862,504	G420V	probably damaging	Het
Nbea	A	T	3: 55,992,401	N1442K	probably damaging	Het
Ndufv1	A	T	19: 4,008,811		probably null	Het
Ofcc1	A	G	13: 40,206,717	S279P	probably benign	Het
Olfr1415	T	C	1: 92,491,717	I13V	probably benign	Het
Olfr730	A	T	14: 50,186,869	M116K	possibly damaging	Het
Pabpc1l	A	T	2: 164,049,518	H552L	probably benign	Het
Pigr	T	A	1: 130,846,604	C440*	probably null	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Prss30	C	T	17: 23,972,846	V271I	probably damaging	Het
Qrich1	T	A	9: 108,533,608		probably benign	Het
Rem1	C	G	2: 152,628,280	A62G	possibly damaging	Het
Rftn1	T	C	17: 50,047,326	N58S	probably damaging	Het
Rp9	G	A	9: 22,448,769		probably benign	Het
Rrp1b	G	A	17: 32,056,684	V402I	possibly damaging	Het
Slc25a33	A	T	4: 149,753,892	Y108N	probably benign	Het
Slc3a1	A	G	17: 85,032,580	M189V	probably damaging	Het
Slc44a1	A	C	4: 53,528,682	K144T	probably benign	Het
Tbc1d13	T	A	2: 30,137,381	H100Q	probably damaging	Het
Timm29	T	C	9: 21,593,453	V139A	probably damaging	Het
Tmem70	T	C	1: 16,665,332	W9R	possibly damaging	Het
Tspan1	A	G	4: 116,163,305		probably null	Het
Unc13a	T	C	8: 71,655,129		probably null	Het
Uroc1	T	C	6: 90,346,756	F395S	probably damaging	Het
Uvrag	A	C	7: 98,888,077	L637R	possibly damaging	Het
Vmn1r213	T	G	13: 23,011,514	L3W	probably benign	Het
Zfp280d	C	T	9: 72,330,942	T528I	probably benign	Het
Zfp526	C	T	7: 25,225,176	Q287*	probably null	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCAGCTTAGTTAGTATGGACAAC -3'
(R):5'- AGTTTATACCCCATGGAGCAAAC -3'

Sequencing Primer
(F):5'- ACAACATAGTAAGGAACACGATTG -3'
(R):5'- CTGATTCTCATTCACTAACAC -3'

Posted On

2017-02-10