Incidental Mutation 'R5853:Clmn'
ID454777
Institutional Source Beutler Lab
Gene Symbol Clmn
Ensembl Gene ENSMUSG00000021097
Gene Namecalmin
Synonyms
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104763117-104865076 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 104783902 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109936] [ENSMUST00000109937] [ENSMUST00000222323] [ENSMUST00000223103] [ENSMUST00000223177] [ENSMUST00000223342]
Predicted Effect probably null
Transcript: ENSMUST00000109936
SMART Domains Protein: ENSMUSP00000105562
Gene: ENSMUSG00000021097

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 996 1013 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109937
SMART Domains Protein: ENSMUSP00000105563
Gene: ENSMUSG00000021097

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 1027 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222412
Predicted Effect probably benign
Transcript: ENSMUST00000223103
Predicted Effect probably benign
Transcript: ENSMUST00000223177
Predicted Effect probably benign
Transcript: ENSMUST00000223342
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Clmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Clmn APN 12 104774551 critical splice acceptor site probably null
IGL01509:Clmn APN 12 104780903 missense probably benign 0.00
IGL01530:Clmn APN 12 104791856 missense probably damaging 1.00
IGL01768:Clmn APN 12 104781719 missense probably damaging 0.99
IGL01779:Clmn APN 12 104782140 missense probably benign 0.04
IGL02139:Clmn APN 12 104781099 missense probably benign 0.01
IGL02157:Clmn APN 12 104781918 missense probably benign 0.00
IGL02519:Clmn APN 12 104791853 missense probably damaging 1.00
IGL02820:Clmn APN 12 104773234 missense probably damaging 0.99
IGL03036:Clmn APN 12 104774523 missense probably damaging 0.97
R0255:Clmn UTSW 12 104781764 missense probably benign
R0478:Clmn UTSW 12 104785491 missense probably damaging 0.99
R0739:Clmn UTSW 12 104781017 missense possibly damaging 0.55
R0761:Clmn UTSW 12 104781558 missense probably damaging 0.99
R0834:Clmn UTSW 12 104771826 missense probably damaging 1.00
R0834:Clmn UTSW 12 104771827 missense probably damaging 1.00
R0864:Clmn UTSW 12 104790015 missense possibly damaging 0.94
R1569:Clmn UTSW 12 104781081 missense probably damaging 1.00
R1638:Clmn UTSW 12 104782022 missense probably benign 0.13
R1940:Clmn UTSW 12 104790102 missense probably damaging 1.00
R1974:Clmn UTSW 12 104791862 missense probably damaging 1.00
R2113:Clmn UTSW 12 104780808 missense probably benign
R4815:Clmn UTSW 12 104785566 missense probably damaging 1.00
R4863:Clmn UTSW 12 104797094 missense probably damaging 1.00
R4883:Clmn UTSW 12 104782048 missense probably benign 0.04
R5577:Clmn UTSW 12 104777070 missense probably damaging 1.00
R5867:Clmn UTSW 12 104781755 missense probably damaging 0.98
R6041:Clmn UTSW 12 104781872 missense probably benign 0.00
R6093:Clmn UTSW 12 104771956 missense probably benign 0.00
R6233:Clmn UTSW 12 104785455 missense probably damaging 1.00
R6239:Clmn UTSW 12 104780845 missense probably benign 0.00
R6628:Clmn UTSW 12 104773786 missense probably damaging 1.00
R6771:Clmn UTSW 12 104773782 missense probably benign 0.04
R7448:Clmn UTSW 12 104785428 missense possibly damaging 0.90
R7633:Clmn UTSW 12 104782112 missense probably benign
R8901:Clmn UTSW 12 104780952 missense probably benign 0.20
R8937:Clmn UTSW 12 104797082 missense probably damaging 1.00
X0028:Clmn UTSW 12 104785402 missense probably benign 0.11
Z1177:Clmn UTSW 12 104781376 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTCACAGGTGGTTTAGAAATGG -3'
(R):5'- GGCAGCCACCTTTAACCAAG -3'

Sequencing Primer
(F):5'- CACAGGTGGTTTAGAAATGGAAATAG -3'
(R):5'- CTCAGAGTCTAAATTTCTTCCAGGGG -3'
Posted On2017-02-10