Mutagenetix > Incidental Mutation

Incidental Mutation 'R5853:Aoah'

454778

Institutional Source

Beutler Lab

Gene Symbol

Aoah

Ensembl Gene

ENSMUSG00000021322

Gene Name

acyloxyacyl hydrolase

Synonyms

MMRRC Submission

044068-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5853 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20794113-21036617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20999902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 379 (A379S)

Ref Sequence

ENSEMBL: ENSMUSP00000021757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021757]

AlphaFold

O35298

Predicted Effect

probably benign
Transcript: ENSMUST00000021757
AA Change: A379S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000021757
Gene: ENSMUSG00000021322
AA Change: A379S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SapB	38	113	6.25e-15	SMART
Pfam:Lipase_GDSL	256	542	4.8e-19	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This genes encodes an enzyme that catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides. The encoded protein modulates host inflammatory response to gram-negative bacteria. The proprotein is further cleaved into a large and small chain that interact in a heterodimer. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice have a reduced ability to deacylate bacterial lipopolysaccharides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	G	A	7: 120,340,583	V303I	probably benign	Het
Abca4	G	T	3: 122,103,531	V620L	probably benign	Het
Ankk1	A	T	9: 49,418,695	V320E	possibly damaging	Het
Apol7e	A	G	15: 77,714,467	D44G	probably benign	Het
Atf2	T	C	2: 73,828,469		probably null	Het
Cd209b	T	C	8: 3,926,549		probably null	Het
Chek1	G	A	9: 36,713,687	S366L	probably damaging	Het
Chpf2	T	C	5: 24,592,192	L712P	probably damaging	Het
Clmn	C	A	12: 104,783,902		probably null	Het
Cnksr3	T	C	10: 7,142,977	D178G	probably benign	Het
Cpox	T	C	16: 58,675,417	Y366H	probably damaging	Het
Dnah3	A	G	7: 119,938,833	F3632S	probably damaging	Het
Eif5b	T	A	1: 38,037,307	D645E	probably damaging	Het
Emilin1	G	A	5: 30,918,622	E736K	probably damaging	Het
Gcnt4	G	A	13: 96,946,652	R152Q	probably benign	Het
Il6st	T	C	13: 112,481,537	S162P	probably damaging	Het
Iqub	T	C	6: 24,491,602	K362E	probably benign	Het
Kif22	G	T	7: 127,033,367	P257Q	possibly damaging	Het
Lhx2	T	C	2: 38,369,041	V378A	probably damaging	Het
Lipo1	A	G	19: 33,782,230	V202A	probably benign	Het
Lrp1b	T	A	2: 40,663,726	N366I	unknown	Het
Mbip	T	C	12: 56,335,877	D268G	probably damaging	Het
Mc5r	A	G	18: 68,339,493	M308V	probably benign	Het
Mndal	C	A	1: 173,862,504	G420V	probably damaging	Het
Nbea	A	T	3: 55,992,401	N1442K	probably damaging	Het
Ndufv1	A	T	19: 4,008,811		probably null	Het
Ofcc1	A	G	13: 40,206,717	S279P	probably benign	Het
Olfr1415	T	C	1: 92,491,717	I13V	probably benign	Het
Olfr730	A	T	14: 50,186,869	M116K	possibly damaging	Het
Pabpc1l	A	T	2: 164,049,518	H552L	probably benign	Het
Pigr	T	A	1: 130,846,604	C440*	probably null	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Prss30	C	T	17: 23,972,846	V271I	probably damaging	Het
Psme4	T	A	11: 30,791,234		probably null	Het
Qrich1	T	A	9: 108,533,608		probably benign	Het
Rem1	C	G	2: 152,628,280	A62G	possibly damaging	Het
Rftn1	T	C	17: 50,047,326	N58S	probably damaging	Het
Rp9	G	A	9: 22,448,769		probably benign	Het
Rrp1b	G	A	17: 32,056,684	V402I	possibly damaging	Het
Slc25a33	A	T	4: 149,753,892	Y108N	probably benign	Het
Slc3a1	A	G	17: 85,032,580	M189V	probably damaging	Het
Slc44a1	A	C	4: 53,528,682	K144T	probably benign	Het
Tbc1d13	T	A	2: 30,137,381	H100Q	probably damaging	Het
Timm29	T	C	9: 21,593,453	V139A	probably damaging	Het
Tmem70	T	C	1: 16,665,332	W9R	possibly damaging	Het
Tspan1	A	G	4: 116,163,305		probably null	Het
Unc13a	T	C	8: 71,655,129		probably null	Het
Uroc1	T	C	6: 90,346,756	F395S	probably damaging	Het
Uvrag	A	C	7: 98,888,077	L637R	possibly damaging	Het
Vmn1r213	T	G	13: 23,011,514	L3W	probably benign	Het
Zfp280d	C	T	9: 72,330,942	T528I	probably benign	Het
Zfp526	C	T	7: 25,225,176	Q287*	probably null	Het

Other mutations in Aoah

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01561:Aoah	APN	13	21005094	missense	probably damaging	0.97
IGL01561:Aoah	APN	13	20905735	splice site	probably benign
IGL01717:Aoah	APN	13	20999977	missense	probably damaging	0.99
IGL01997:Aoah	APN	13	20999938	missense	probably benign	0.00
IGL02212:Aoah	APN	13	21002901	missense	probably benign	0.05
IGL02325:Aoah	APN	13	20917125	missense	probably damaging	0.97
IGL03028:Aoah	APN	13	20816582	missense	possibly damaging	0.62
IGL03304:Aoah	APN	13	20915010	splice site	probably benign
IGL03352:Aoah	APN	13	21000043	missense	probably benign	0.01
H8562:Aoah	UTSW	13	20816524	missense	probably damaging	1.00
PIT4402001:Aoah	UTSW	13	20794510	missense	probably benign	0.00
R0255:Aoah	UTSW	13	20979540	nonsense	probably null
R0432:Aoah	UTSW	13	20911198	splice site	probably benign
R0501:Aoah	UTSW	13	21005073	missense	probably benign	0.16
R1036:Aoah	UTSW	13	20840169	splice site	probably benign
R1119:Aoah	UTSW	13	20914938	splice site	probably benign
R1203:Aoah	UTSW	13	20816594	missense	probably damaging	1.00
R1589:Aoah	UTSW	13	21002948	missense	probably damaging	0.99
R1662:Aoah	UTSW	13	21000113	splice site	probably null
R1907:Aoah	UTSW	13	20910094	missense	probably damaging	1.00
R1959:Aoah	UTSW	13	20794394	start codon destroyed	probably null	0.89
R2145:Aoah	UTSW	13	20840096	missense	probably damaging	1.00
R2237:Aoah	UTSW	13	20794311	start gained	probably benign
R3438:Aoah	UTSW	13	20917072	missense	probably benign	0.00
R4226:Aoah	UTSW	13	20979526	missense	possibly damaging	0.50
R4868:Aoah	UTSW	13	20914981	nonsense	probably null
R5026:Aoah	UTSW	13	20914959	missense	probably damaging	1.00
R5139:Aoah	UTSW	13	21023237	missense	possibly damaging	0.61
R5624:Aoah	UTSW	13	20995479	missense	probably damaging	1.00
R6134:Aoah	UTSW	13	20911123	missense	probably damaging	1.00
R6459:Aoah	UTSW	13	20999942	missense	probably damaging	0.99
R7077:Aoah	UTSW	13	20910106	missense	probably damaging	1.00
R7103:Aoah	UTSW	13	21023315	missense	probably damaging	1.00
R8198:Aoah	UTSW	13	20917120	missense	probably damaging	1.00
R8340:Aoah	UTSW	13	20999942	missense	probably damaging	0.99
R8723:Aoah	UTSW	13	21000010	missense	possibly damaging	0.81
R8790:Aoah	UTSW	13	20851670	missense	probably benign	0.16
R8811:Aoah	UTSW	13	20999951	missense	probably damaging	1.00
R8873:Aoah	UTSW	13	20905682	missense	probably benign	0.00
R8973:Aoah	UTSW	13	20840155	missense	probably benign	0.00
R9287:Aoah	UTSW	13	21002709	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGCTTAGTAGGCTCCACTGG -3'
(R):5'- ATGCATTGCTCATACATCACAC -3'

Sequencing Primer
(F):5'- CTCCACTGGAGTTATTAAATGCAG -3'
(R):5'- TATATCTGCACACTCATACAAATAGC -3'

Posted On

2017-02-10