Incidental Mutation 'R5853:Aoah'
ID 454778
Institutional Source Beutler Lab
Gene Symbol Aoah
Ensembl Gene ENSMUSG00000021322
Gene Name acyloxyacyl hydrolase
Synonyms
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5853 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 20794113-21036617 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 20999902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 379 (A379S)
Ref Sequence ENSEMBL: ENSMUSP00000021757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021757]
AlphaFold O35298
Predicted Effect probably benign
Transcript: ENSMUST00000021757
AA Change: A379S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021757
Gene: ENSMUSG00000021322
AA Change: A379S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SapB 38 113 6.25e-15 SMART
Pfam:Lipase_GDSL 256 542 4.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This genes encodes an enzyme that catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides. The encoded protein modulates host inflammatory response to gram-negative bacteria. The proprotein is further cleaved into a large and small chain that interact in a heterodimer. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice have a reduced ability to deacylate bacterial lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Aoah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Aoah APN 13 21005094 missense probably damaging 0.97
IGL01561:Aoah APN 13 20905735 splice site probably benign
IGL01717:Aoah APN 13 20999977 missense probably damaging 0.99
IGL01997:Aoah APN 13 20999938 missense probably benign 0.00
IGL02212:Aoah APN 13 21002901 missense probably benign 0.05
IGL02325:Aoah APN 13 20917125 missense probably damaging 0.97
IGL03028:Aoah APN 13 20816582 missense possibly damaging 0.62
IGL03304:Aoah APN 13 20915010 splice site probably benign
IGL03352:Aoah APN 13 21000043 missense probably benign 0.01
H8562:Aoah UTSW 13 20816524 missense probably damaging 1.00
PIT4402001:Aoah UTSW 13 20794510 missense probably benign 0.00
R0255:Aoah UTSW 13 20979540 nonsense probably null
R0432:Aoah UTSW 13 20911198 splice site probably benign
R0501:Aoah UTSW 13 21005073 missense probably benign 0.16
R1036:Aoah UTSW 13 20840169 splice site probably benign
R1119:Aoah UTSW 13 20914938 splice site probably benign
R1203:Aoah UTSW 13 20816594 missense probably damaging 1.00
R1589:Aoah UTSW 13 21002948 missense probably damaging 0.99
R1662:Aoah UTSW 13 21000113 splice site probably null
R1907:Aoah UTSW 13 20910094 missense probably damaging 1.00
R1959:Aoah UTSW 13 20794394 start codon destroyed probably null 0.89
R2145:Aoah UTSW 13 20840096 missense probably damaging 1.00
R2237:Aoah UTSW 13 20794311 start gained probably benign
R3438:Aoah UTSW 13 20917072 missense probably benign 0.00
R4226:Aoah UTSW 13 20979526 missense possibly damaging 0.50
R4868:Aoah UTSW 13 20914981 nonsense probably null
R5026:Aoah UTSW 13 20914959 missense probably damaging 1.00
R5139:Aoah UTSW 13 21023237 missense possibly damaging 0.61
R5624:Aoah UTSW 13 20995479 missense probably damaging 1.00
R6134:Aoah UTSW 13 20911123 missense probably damaging 1.00
R6459:Aoah UTSW 13 20999942 missense probably damaging 0.99
R7077:Aoah UTSW 13 20910106 missense probably damaging 1.00
R7103:Aoah UTSW 13 21023315 missense probably damaging 1.00
R8198:Aoah UTSW 13 20917120 missense probably damaging 1.00
R8340:Aoah UTSW 13 20999942 missense probably damaging 0.99
R8723:Aoah UTSW 13 21000010 missense possibly damaging 0.81
R8790:Aoah UTSW 13 20851670 missense probably benign 0.16
R8811:Aoah UTSW 13 20999951 missense probably damaging 1.00
R8873:Aoah UTSW 13 20905682 missense probably benign 0.00
R8973:Aoah UTSW 13 20840155 missense probably benign 0.00
R9287:Aoah UTSW 13 21002709 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTTAGTAGGCTCCACTGG -3'
(R):5'- ATGCATTGCTCATACATCACAC -3'

Sequencing Primer
(F):5'- CTCCACTGGAGTTATTAAATGCAG -3'
(R):5'- TATATCTGCACACTCATACAAATAGC -3'
Posted On 2017-02-10