Mutagenetix > Incidental Mutation

Incidental Mutation 'R5853:Cpox'

454787

Institutional Source

Beutler Lab

Gene Symbol

Cpox

Ensembl Gene

ENSMUSG00000022742

Gene Name

coproporphyrinogen oxidase

Synonyms

nct, Cpo, cac, clone 560

MMRRC Submission

044068-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5853 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58670292-58717636 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58675417 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 366 (Y366H)

Ref Sequence

ENSEMBL: ENSMUSP00000055455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060077]

AlphaFold

P36552

Predicted Effect

probably damaging
Transcript: ENSMUST00000060077
AA Change: Y366H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000055455
Gene: ENSMUSG00000022742
AA Change: Y366H

Domain	Start	End	E-Value	Type
low complexity region	57	81	N/A	INTRINSIC
low complexity region	94	105	N/A	INTRINSIC
Pfam:Coprogen_oxidas	140	442	7.6e-142	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231492

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232176

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232532

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a spontaneous allele develop cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	G	A	7: 120,340,583	V303I	probably benign	Het
Abca4	G	T	3: 122,103,531	V620L	probably benign	Het
Ankk1	A	T	9: 49,418,695	V320E	possibly damaging	Het
Aoah	G	T	13: 20,999,902	A379S	probably benign	Het
Apol7e	A	G	15: 77,714,467	D44G	probably benign	Het
Atf2	T	C	2: 73,828,469		probably null	Het
Cd209b	T	C	8: 3,926,549		probably null	Het
Chek1	G	A	9: 36,713,687	S366L	probably damaging	Het
Chpf2	T	C	5: 24,592,192	L712P	probably damaging	Het
Clmn	C	A	12: 104,783,902		probably null	Het
Cnksr3	T	C	10: 7,142,977	D178G	probably benign	Het
Dnah3	A	G	7: 119,938,833	F3632S	probably damaging	Het
Eif5b	T	A	1: 38,037,307	D645E	probably damaging	Het
Emilin1	G	A	5: 30,918,622	E736K	probably damaging	Het
Gcnt4	G	A	13: 96,946,652	R152Q	probably benign	Het
Il6st	T	C	13: 112,481,537	S162P	probably damaging	Het
Iqub	T	C	6: 24,491,602	K362E	probably benign	Het
Kif22	G	T	7: 127,033,367	P257Q	possibly damaging	Het
Lhx2	T	C	2: 38,369,041	V378A	probably damaging	Het
Lipo1	A	G	19: 33,782,230	V202A	probably benign	Het
Lrp1b	T	A	2: 40,663,726	N366I	unknown	Het
Mbip	T	C	12: 56,335,877	D268G	probably damaging	Het
Mc5r	A	G	18: 68,339,493	M308V	probably benign	Het
Mndal	C	A	1: 173,862,504	G420V	probably damaging	Het
Nbea	A	T	3: 55,992,401	N1442K	probably damaging	Het
Ndufv1	A	T	19: 4,008,811		probably null	Het
Ofcc1	A	G	13: 40,206,717	S279P	probably benign	Het
Olfr1415	T	C	1: 92,491,717	I13V	probably benign	Het
Olfr730	A	T	14: 50,186,869	M116K	possibly damaging	Het
Pabpc1l	A	T	2: 164,049,518	H552L	probably benign	Het
Pigr	T	A	1: 130,846,604	C440*	probably null	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Prss30	C	T	17: 23,972,846	V271I	probably damaging	Het
Psme4	T	A	11: 30,791,234		probably null	Het
Qrich1	T	A	9: 108,533,608		probably benign	Het
Rem1	C	G	2: 152,628,280	A62G	possibly damaging	Het
Rftn1	T	C	17: 50,047,326	N58S	probably damaging	Het
Rp9	G	A	9: 22,448,769		probably benign	Het
Rrp1b	G	A	17: 32,056,684	V402I	possibly damaging	Het
Slc25a33	A	T	4: 149,753,892	Y108N	probably benign	Het
Slc3a1	A	G	17: 85,032,580	M189V	probably damaging	Het
Slc44a1	A	C	4: 53,528,682	K144T	probably benign	Het
Tbc1d13	T	A	2: 30,137,381	H100Q	probably damaging	Het
Timm29	T	C	9: 21,593,453	V139A	probably damaging	Het
Tmem70	T	C	1: 16,665,332	W9R	possibly damaging	Het
Tspan1	A	G	4: 116,163,305		probably null	Het
Unc13a	T	C	8: 71,655,129		probably null	Het
Uroc1	T	C	6: 90,346,756	F395S	probably damaging	Het
Uvrag	A	C	7: 98,888,077	L637R	possibly damaging	Het
Vmn1r213	T	G	13: 23,011,514	L3W	probably benign	Het
Zfp280d	C	T	9: 72,330,942	T528I	probably benign	Het
Zfp526	C	T	7: 25,225,176	Q287*	probably null	Het

Other mutations in Cpox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02152:Cpox	APN	16	58674424	missense	possibly damaging	0.87
IGL03031:Cpox	APN	16	58672560	missense	probably damaging	1.00
IGL03034:Cpox	APN	16	58675355	missense	probably damaging	0.98
scraggy	UTSW	16	58670935	missense	probably damaging	1.00
R0413:Cpox	UTSW	16	58670869	missense	possibly damaging	0.52
R0523:Cpox	UTSW	16	58675245	nonsense	probably null
R0551:Cpox	UTSW	16	58675390	missense	probably benign	0.11
R2064:Cpox	UTSW	16	58674409	missense	probably benign	0.36
R4651:Cpox	UTSW	16	58670687	missense	possibly damaging	0.92
R4701:Cpox	UTSW	16	58677969	nonsense	probably null
R4782:Cpox	UTSW	16	58672623	missense	probably damaging	1.00
R5285:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5287:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5313:Cpox	UTSW	16	58677948	nonsense	probably null
R5346:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5354:Cpox	UTSW	16	58670842	missense	probably damaging	0.99
R5404:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5476:Cpox	UTSW	16	58678725	missense	probably damaging	0.99
R6026:Cpox	UTSW	16	58670935	missense	probably damaging	1.00
R7059:Cpox	UTSW	16	58670927	missense	probably damaging	1.00
R7061:Cpox	UTSW	16	58670860	missense	possibly damaging	0.76
R7606:Cpox	UTSW	16	58674449	missense	probably benign	0.16
R8753:Cpox	UTSW	16	58678028	missense	probably damaging	1.00
R8779:Cpox	UTSW	16	58670866	missense	probably damaging	1.00
R8793:Cpox	UTSW	16	58673345	missense	probably damaging	1.00
R9667:Cpox	UTSW	16	58670621	missense	possibly damaging	0.52
R9736:Cpox	UTSW	16	58674383	missense	probably benign	0.00
RF059:Cpox	UTSW	16	58670767	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCGTTCTAGGTGTGACGACTAC -3'
(R):5'- CAAGTTCTTACCACGTAAATGCC -3'

Sequencing Primer
(F):5'- ACTTCTTTATAGTTCACCGCGGGG -3'
(R):5'- TTGAACTCCTGACCTTCGGAAGAG -3'

Posted On

2017-02-10