Incidental Mutation 'R5853:Rrp1b'
ID454789
Institutional Source Beutler Lab
Gene Symbol Rrp1b
Ensembl Gene ENSMUSG00000058392
Gene Nameribosomal RNA processing 1 homolog B (S. cerevisiae)
Synonyms
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32036100-32062865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32056684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 402 (V402I)
Ref Sequence ENSEMBL: ENSMUSP00000080085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081339] [ENSMUST00000150469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081339
AA Change: V402I

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080085
Gene: ENSMUSG00000058392
AA Change: V402I

DomainStartEndE-ValueType
Pfam:Nop52 10 218 3.3e-73 PFAM
low complexity region 344 352 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 450 463 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150469
SMART Domains Protein: ENSMUSP00000117400
Gene: ENSMUSG00000058392

DomainStartEndE-ValueType
low complexity region 96 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Rrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Rrp1b APN 17 32052819 missense probably benign 0.09
IGL01383:Rrp1b APN 17 32058578 missense probably damaging 0.99
IGL02740:Rrp1b APN 17 32059331 missense probably damaging 1.00
IGL03030:Rrp1b APN 17 32056901 missense probably damaging 1.00
IGL03181:Rrp1b APN 17 32057176 missense probably benign 0.13
IGL03396:Rrp1b APN 17 32057263 splice site probably benign
IGL02980:Rrp1b UTSW 17 32050039 missense possibly damaging 0.49
R0138:Rrp1b UTSW 17 32060452 missense probably benign 0.24
R0394:Rrp1b UTSW 17 32058564 missense probably benign 0.34
R0681:Rrp1b UTSW 17 32060395 missense probably damaging 1.00
R1315:Rrp1b UTSW 17 32056639 missense probably benign 0.00
R1351:Rrp1b UTSW 17 32056637 missense possibly damaging 0.82
R1700:Rrp1b UTSW 17 32057204 missense probably benign 0.19
R1815:Rrp1b UTSW 17 32056811 missense probably benign
R1940:Rrp1b UTSW 17 32056845 missense possibly damaging 0.95
R2176:Rrp1b UTSW 17 32056560 missense probably benign 0.00
R2352:Rrp1b UTSW 17 32059328 missense possibly damaging 0.71
R2975:Rrp1b UTSW 17 32058573 missense probably damaging 1.00
R4552:Rrp1b UTSW 17 32056010 splice site probably benign
R5114:Rrp1b UTSW 17 32036471 utr 5 prime probably benign
R5242:Rrp1b UTSW 17 32051703 missense possibly damaging 0.82
R5647:Rrp1b UTSW 17 32056011 splice site probably benign
R5739:Rrp1b UTSW 17 32045976 missense probably damaging 1.00
R5878:Rrp1b UTSW 17 32047675 missense probably damaging 1.00
R6389:Rrp1b UTSW 17 32056627 missense possibly damaging 0.55
R6734:Rrp1b UTSW 17 32055304 intron probably benign
R6742:Rrp1b UTSW 17 32056934 missense probably benign
R6759:Rrp1b UTSW 17 32057089 missense probably benign 0.01
R6855:Rrp1b UTSW 17 32052745 missense probably benign 0.00
R7014:Rrp1b UTSW 17 32049427 missense probably damaging 1.00
R7315:Rrp1b UTSW 17 32058571 missense probably benign 0.03
R7689:Rrp1b UTSW 17 32055926 missense probably benign 0.38
R7834:Rrp1b UTSW 17 32051724 missense probably benign 0.00
R7917:Rrp1b UTSW 17 32051724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCACCAGCAGGGCTTTG -3'
(R):5'- TCTGAGAATGCCCACTGACAG -3'

Sequencing Primer
(F):5'- CCAGCAGGGCTTTGCATCATTG -3'
(R):5'- AGATCTCTTTGTGGGCCCTCAG -3'
Posted On2017-02-10