Incidental Mutation 'R5854:Nans'
ID454810
Institutional Source Beutler Lab
Gene Symbol Nans
Ensembl Gene ENSMUSG00000028334
Gene NameN-acetylneuraminic acid synthase (sialic acid synthase)
Synonyms4632418E04Rik, N-acetylneuraminic acid phosphate synthase, Sas
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R5854 (G1)
Quality Score145
Status Not validated
Chromosome4
Chromosomal Location46489248-46503632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46500180 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 188 (Y188C)
Ref Sequence ENSEMBL: ENSMUSP00000030018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030018] [ENSMUST00000184112]
Predicted Effect probably damaging
Transcript: ENSMUST00000030018
AA Change: Y188C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030018
Gene: ENSMUSG00000028334
AA Change: Y188C

DomainStartEndE-ValueType
Pfam:NeuB 39 278 4.7e-81 PFAM
SAF 292 351 2.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150584
Predicted Effect probably benign
Transcript: ENSMUST00000184112
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that functions in the biosynthetic pathways of sialic acids. In vitro, the encoded protein uses N-acetylmannosamine 6-phosphate and mannose 6-phosphate as substrates to generate phosphorylated forms of N-acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN), respectively; however, it exhibits much higher activity toward the Neu5Ac phosphate product. In insect cells, expression of this gene results in Neu5Ac and KDN production. This gene is related to the E. coli sialic acid synthase gene neuB, and it can partially restore sialic acid synthase activity in an E. coli neuB-negative mutant. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Nans
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1016:Nans UTSW 4 46500716 missense probably benign 0.23
R1192:Nans UTSW 4 46502430 intron probably benign
R1493:Nans UTSW 4 46500761 missense probably damaging 1.00
R1912:Nans UTSW 4 46500162 missense probably damaging 1.00
R3799:Nans UTSW 4 46492839 missense probably benign 0.05
R4980:Nans UTSW 4 46492764 missense probably benign 0.03
R5212:Nans UTSW 4 46502547 missense possibly damaging 0.56
R5723:Nans UTSW 4 46499083 missense probably benign 0.08
R5990:Nans UTSW 4 46489441 missense probably damaging 0.99
R7474:Nans UTSW 4 46502484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACAGTGTATCTCCTCCTCAG -3'
(R):5'- AAGTCTCTCATTGAGGGCGG -3'

Sequencing Primer
(F):5'- CTCCTCAGTCTTGGTGCGG -3'
(R):5'- TAAGACCTGACTGCGGGACATTTC -3'
Posted On2017-02-10