Incidental Mutation 'R5854:4930553M12Rik'
ID454811
Institutional Source Beutler Lab
Gene Symbol 4930553M12Rik
Ensembl Gene ENSMUSG00000054351
Gene NameRIKEN cDNA 4930553M12 gene
Synonyms
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88867882-88868379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88868359 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 7 (I7M)
Ref Sequence ENSEMBL: ENSMUSP00000052657 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000057837
AA Change: I7M
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in 4930553M12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:4930553M12Rik APN 4 88868073 nonsense probably null
R0194:4930553M12Rik UTSW 4 88868243 missense unknown
R2143:4930553M12Rik UTSW 4 88868174 missense unknown
R2143:4930553M12Rik UTSW 4 88868175 missense unknown
R2144:4930553M12Rik UTSW 4 88868174 missense unknown
R2144:4930553M12Rik UTSW 4 88868175 missense unknown
R5135:4930553M12Rik UTSW 4 88868271 missense unknown
R5822:4930553M12Rik UTSW 4 88868359 missense unknown
R5848:4930553M12Rik UTSW 4 88868359 missense unknown
R5849:4930553M12Rik UTSW 4 88868359 missense unknown
R5850:4930553M12Rik UTSW 4 88868359 missense unknown
R5856:4930553M12Rik UTSW 4 88868359 missense unknown
R6128:4930553M12Rik UTSW 4 88868359 missense unknown
R6130:4930553M12Rik UTSW 4 88868359 missense unknown
R7054:4930553M12Rik UTSW 4 88868249 missense unknown
R7292:4930553M12Rik UTSW 4 88868331 missense unknown
R7754:4930553M12Rik UTSW 4 88868259 missense unknown
R7844:4930553M12Rik UTSW 4 88868186 missense unknown
R7927:4930553M12Rik UTSW 4 88868186 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTTCTCGCCCAAAGAATC -3'
(R):5'- CAAAGAATATTCTGGCACTGGG -3'

Sequencing Primer
(F):5'- AAAGAATCCGCTTATTCCCCTG -3'
(R):5'- CCTTTTGGAGCCAGCCAAC -3'
Posted On2017-02-10