Incidental Mutation 'R5854:Hnrnpa2b1'
ID454816
Institutional Source Beutler Lab
Gene Symbol Hnrnpa2b1
Ensembl Gene ENSMUSG00000004980
Gene Nameheterogeneous nuclear ribonucleoprotein A2/B1
Synonyms9130414A06Rik, Hnrpa2, Hnrpa2b1
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location51460932-51469894 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to G at 51466609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031862] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000094623] [ENSMUST00000114445] [ENSMUST00000114446] [ENSMUST00000114459] [ENSMUST00000141711] [ENSMUST00000203220] [ENSMUST00000203954] [ENSMUST00000204158] [ENSMUST00000204188]
Predicted Effect probably benign
Transcript: ENSMUST00000031862
SMART Domains Protein: ENSMUSP00000031862
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000069949
AA Change: E121Q
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980
AA Change: E121Q

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000090002
AA Change: E121Q
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980
AA Change: E121Q

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094623
SMART Domains Protein: ENSMUSP00000110091
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114445
SMART Domains Protein: ENSMUSP00000110088
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
Pfam:Chromo 30 60 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114446
SMART Domains Protein: ENSMUSP00000110089
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 113 N/A INTRINSIC
ChSh 115 177 6.46e-34 SMART
CHROMO 120 172 5.92e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114459
AA Change: E133Q
SMART Domains Protein: ENSMUSP00000110103
Gene: ENSMUSG00000004980
AA Change: E133Q

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141711
SMART Domains Protein: ENSMUSP00000121370
Gene: ENSMUSG00000029836

DomainStartEndE-ValueType
CHROMO 29 81 2.03e-17 SMART
low complexity region 90 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156463
Predicted Effect unknown
Transcript: ENSMUST00000203220
AA Change: E121Q
SMART Domains Protein: ENSMUSP00000145374
Gene: ENSMUSG00000004980
AA Change: E121Q

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203253
AA Change: E31Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203655
Predicted Effect unknown
Transcript: ENSMUST00000203954
AA Change: E133Q
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980
AA Change: E133Q

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204090
Predicted Effect unknown
Transcript: ENSMUST00000204158
AA Change: E121Q
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980
AA Change: E121Q

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000204188
AA Change: E121Q
SMART Domains Protein: ENSMUSP00000145245
Gene: ENSMUSG00000004980
AA Change: E121Q

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205204
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Hnrnpa2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Hnrnpa2b1 APN 6 51467013 missense probably damaging 1.00
PIT4142001:Hnrnpa2b1 UTSW 6 51464109 missense probably benign 0.10
R1617:Hnrnpa2b1 UTSW 6 51466398 missense possibly damaging 0.69
R4694:Hnrnpa2b1 UTSW 6 51464183 missense probably damaging 1.00
R5422:Hnrnpa2b1 UTSW 6 51465228 missense probably benign 0.23
R7666:Hnrnpa2b1 UTSW 6 51466937 missense possibly damaging 0.53
RF020:Hnrnpa2b1 UTSW 6 51466694 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACAATGCCTTTCTAACTTCTGC -3'
(R):5'- ACCTATTATCTGGAGGAATTCGTC -3'

Sequencing Primer
(F):5'- ACTTCTGCATTGTGACCATTTATG -3'
(R):5'- TTCGTCCTAAGATGTACAAATACAAG -3'
Posted On2017-02-10