Mutagenetix > Incidental Mutation

Incidental Mutation 'R5854:Lonp2'

454824

Institutional Source

Beutler Lab

Gene Symbol

Lonp2

Ensembl Gene

ENSMUSG00000047866

Gene Name

lon peptidase 2, peroxisomal

Synonyms

1300002A08Rik

MMRRC Submission

043228-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R5854 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

86624043-86723873 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 86673071 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000121673] [ENSMUST00000121673] [ENSMUST00000122188] [ENSMUST00000155433] [ENSMUST00000163987]

AlphaFold

Q9DBN5

Predicted Effect

probably null
Transcript: ENSMUST00000034141

SMART Domains

Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866

Domain	Start	End	E-Value	Type
Pfam:LON_substr_bdg	12	220	1e-24	PFAM
low complexity region	243	255	N/A	INTRINSIC
low complexity region	259	269	N/A	INTRINSIC
AAA	367	512	1.59e-10	SMART
low complexity region	538	545	N/A	INTRINSIC
Pfam:Lon_C	628	837	1.6e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082690

Predicted Effect

probably null
Transcript: ENSMUST00000121673

SMART Domains

Protein: ENSMUSP00000113381
Gene: ENSMUSG00000047866

Domain	Start	End	E-Value	Type
Pfam:AAA	1	93	8.7e-10	PFAM
low complexity region	118	125	N/A	INTRINSIC
Pfam:Lon_C	208	417	3.2e-85	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000121673

SMART Domains

Protein: ENSMUSP00000113381
Gene: ENSMUSG00000047866

Domain	Start	End	E-Value	Type
Pfam:AAA	1	93	8.7e-10	PFAM
low complexity region	118	125	N/A	INTRINSIC
Pfam:Lon_C	208	417	3.2e-85	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000122188

SMART Domains

Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866

Domain	Start	End	E-Value	Type
Pfam:LON	12	224	9e-17	PFAM
AAA	225	370	1.59e-10	SMART
low complexity region	396	403	N/A	INTRINSIC
Pfam:Lon_C	486	695	1.5e-83	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155433

SMART Domains

Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866

Domain	Start	End	E-Value	Type
Pfam:LON	12	220	3.3e-26	PFAM
low complexity region	243	255	N/A	INTRINSIC
low complexity region	259	269	N/A	INTRINSIC
AAA	367	512	1.59e-10	SMART
low complexity region	538	545	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163987

SMART Domains

Protein: ENSMUSP00000127938
Gene: ENSMUSG00000047866

Domain	Start	End	E-Value	Type
Pfam:AAA	1	93	8.7e-10	PFAM
low complexity region	118	125	N/A	INTRINSIC
Pfam:Lon_C	208	417	3.2e-85	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Atg4c	G	A	4: 99,228,559	V313I	probably benign	Het
Ccdc18	A	G	5: 108,206,728	E1111G	possibly damaging	Het
Chuk	T	C	19: 44,081,957	H573R	probably benign	Het
Cst13	A	G	2: 148,828,174	N88S	probably benign	Het
Dalrd3	T	C	9: 108,570,077		probably null	Het
Dnah8	T	A	17: 30,794,763	M3826K	possibly damaging	Het
Dsp	A	G	13: 38,167,501		probably null	Het
Fbxo41	A	G	6: 85,475,094	L810P	probably damaging	Het
Fcrlb	T	C	1: 170,907,961	Y248C	probably damaging	Het
Gmcl1	A	G	6: 86,714,259		silent	Het
Gtf3c3	C	A	1: 54,419,437	A442S	probably benign	Het
Hdac4	T	C	1: 91,959,421	S799G	probably damaging	Het
Hnrnpa2b1	C	G	6: 51,466,609		probably benign	Het
Hnrnpab	T	C	11: 51,604,681	E177G	probably damaging	Het
Knl1	A	G	2: 119,070,403	I862V	probably benign	Het
Map3k19	G	T	1: 127,830,355	P363T	probably damaging	Het
Morn3	A	G	5: 123,041,115	Y91H	probably damaging	Het
Myom2	A	G	8: 15,108,478	D810G	probably benign	Het
Nans	A	G	4: 46,500,180	Y188C	probably damaging	Het
Ndufs1	A	T	1: 63,147,389	D1E	probably benign	Het
Nelfb	T	C	2: 25,209,993	N204S	probably damaging	Het
Noxo1	T	C	17: 24,698,542	S31P	probably damaging	Het
Olfr312	T	A	11: 58,831,556	M134K	probably damaging	Het
Olfr53	A	G	7: 140,652,578	M200V	probably benign	Het
Olfr914	T	C	9: 38,606,663	L66S	probably damaging	Het
Pkd1l2	T	G	8: 117,065,746	T436P	possibly damaging	Het
Pkhd1l1	A	G	15: 44,581,790	D3686G	probably damaging	Het
Ppp2r5b	A	G	19: 6,230,944	L285S	probably damaging	Het
Pzp	A	T	6: 128,506,869	V522D	probably benign	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Rpe65	A	G	3: 159,615,676	D375G	probably benign	Het
Sacs	C	T	14: 61,211,547	L3681F	probably damaging	Het
Sft2d1	C	T	17: 8,320,653	T96I	probably damaging	Het
Slc12a7	A	G	13: 73,793,940	N312D	probably benign	Het
Spaca6	A	T	17: 17,831,247	K82*	probably null	Het
Stk32c	A	G	7: 139,188,279		probably benign	Het
Tet2	T	A	3: 133,487,885	N263Y	probably damaging	Het
Uxs1	T	C	1: 43,780,073	N190S	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Lonp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Lonp2	APN	8	86633972	missense	probably damaging	1.00
IGL00990:Lonp2	APN	8	86641533	splice site	probably benign
IGL01654:Lonp2	APN	8	86714086	missense	probably damaging	1.00
IGL02021:Lonp2	APN	8	86708971	missense	probably benign	0.00
IGL02165:Lonp2	APN	8	86709026	missense	probably damaging	1.00
IGL02309:Lonp2	APN	8	86634863	missense	probably damaging	1.00
IGL02355:Lonp2	APN	8	86624246	missense	probably benign	0.17
IGL02362:Lonp2	APN	8	86624246	missense	probably benign	0.17
IGL02365:Lonp2	APN	8	86716365	missense	possibly damaging	0.69
IGL02374:Lonp2	APN	8	86709045	missense	probably damaging	0.97
IGL02440:Lonp2	APN	8	86624185	start codon destroyed	probably null	0.98
Furcht	UTSW	8	86631502	missense	probably benign	0.09
Horror	UTSW	8	86624248	missense	probably damaging	1.00
Shellshock	UTSW	8	86709013	missense	probably damaging	1.00
R0083:Lonp2	UTSW	8	86716355	missense	probably benign	0.13
R0108:Lonp2	UTSW	8	86716355	missense	probably benign	0.13
R0108:Lonp2	UTSW	8	86716355	missense	probably benign	0.13
R0129:Lonp2	UTSW	8	86634890	missense	probably damaging	0.99
R0302:Lonp2	UTSW	8	86637991	missense	possibly damaging	0.94
R0433:Lonp2	UTSW	8	86633954	missense	probably damaging	1.00
R1148:Lonp2	UTSW	8	86636540	missense	probably benign	0.00
R1148:Lonp2	UTSW	8	86636540	missense	probably benign	0.00
R1413:Lonp2	UTSW	8	86641584	missense	probably damaging	1.00
R1589:Lonp2	UTSW	8	86673072	splice site	probably benign
R1635:Lonp2	UTSW	8	86713450	missense	possibly damaging	0.78
R1654:Lonp2	UTSW	8	86631450	missense	probably damaging	0.99
R2033:Lonp2	UTSW	8	86708942	missense	possibly damaging	0.77
R2062:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R2065:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R2066:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R2068:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R4321:Lonp2	UTSW	8	86665728	missense	probably damaging	1.00
R4713:Lonp2	UTSW	8	86713315	missense	probably damaging	0.98
R4750:Lonp2	UTSW	8	86631502	missense	probably benign	0.09
R5790:Lonp2	UTSW	8	86631490	missense	probably benign	0.24
R5884:Lonp2	UTSW	8	86641626	missense	probably damaging	1.00
R6025:Lonp2	UTSW	8	86713373	missense	probably damaging	1.00
R6236:Lonp2	UTSW	8	86636587	nonsense	probably null
R6481:Lonp2	UTSW	8	86634908	missense	possibly damaging	0.69
R6534:Lonp2	UTSW	8	86716458	missense	probably benign	0.00
R6805:Lonp2	UTSW	8	86709096	missense	probably benign
R6983:Lonp2	UTSW	8	86624248	missense	probably damaging	1.00
R7330:Lonp2	UTSW	8	86631394	missense	probably damaging	1.00
R7641:Lonp2	UTSW	8	86665758	missense	probably benign	0.02
R7674:Lonp2	UTSW	8	86665758	missense	probably benign	0.02
R7711:Lonp2	UTSW	8	86714008	missense	probably damaging	0.99
R7826:Lonp2	UTSW	8	86709013	missense	probably damaging	1.00
R7999:Lonp2	UTSW	8	86634909	missense	probably benign	0.02
R8057:Lonp2	UTSW	8	86714089	missense	probably damaging	1.00
R8193:Lonp2	UTSW	8	86631463	missense	probably damaging	1.00
R8716:Lonp2	UTSW	8	86716305	missense	probably benign	0.20
R8766:Lonp2	UTSW	8	86636570	missense	probably benign	0.00
R8813:Lonp2	UTSW	8	86631445	missense	probably damaging	1.00
R9049:Lonp2	UTSW	8	86709107	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTTAGGGAACTGGCTGTCC -3'
(R):5'- TGTACCCACTGTAGCAATCTG -3'

Sequencing Primer
(F):5'- GACAGAAAGTTTGGGGCT -3'
(R):5'- CACTGTAGCAATCTGGAGAAAATAAC -3'

Posted On

2017-02-10