Incidental Mutation 'R5854:Slc12a7'
ID454835
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Namesolute carrier family 12, member 7
SynonymsKcc4
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73733094-73816754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73793940 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 312 (N312D)
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900] [ENSMUST00000220535]
Predicted Effect probably benign
Transcript: ENSMUST00000017900
AA Change: N312D

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220522
Predicted Effect probably benign
Transcript: ENSMUST00000220535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223008
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3023:Slc12a7 UTSW 13 73800422 missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73785139 missense probably benign
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73798969 missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73763962 intron probably benign
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTTCCAGAGTAAGTTGCCC -3'
(R):5'- GGATGCCCTGTATCTCAGTAAC -3'

Sequencing Primer
(F):5'- AGATCAGTCTTCAAGCTGCTGGAC -3'
(R):5'- CTCAGTAACGTTGTTCTGTGCAAAG -3'
Posted On2017-02-10