Mutagenetix > Incidental Mutation

Incidental Mutation 'R5854:Rictor'

454837

Institutional Source

Beutler Lab

Gene Symbol

Rictor

Ensembl Gene

ENSMUSG00000050310

Gene Name

RPTOR independent companion of MTOR, complex 2

Synonyms

D530039E11Rik, 4921505C17Rik, 6030405M08Rik

MMRRC Submission

043228-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5854 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6708379-6800401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 6794006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1555 (E1555K)

Ref Sequence

ENSEMBL: ENSMUSP00000051809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061656]

AlphaFold

Q6QI06

Predicted Effect

probably benign
Transcript: ENSMUST00000061656
AA Change: E1555K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: E1555K

Domain	Start	End	E-Value	Type
RICTOR_N	57	439	4.02e-185	SMART
RICTOR_M	523	742	5.66e-98	SMART
RasGEF_N_2	743	857	1.26e-54	SMART
RICTOR_V	920	992	1.44e-40	SMART
low complexity region	1019	1043	N/A	INTRINSIC
RICTOR_phospho	1084	1189	4.06e-58	SMART
low complexity region	1221	1239	N/A	INTRINSIC
low complexity region	1255	1266	N/A	INTRINSIC
low complexity region	1273	1287	N/A	INTRINSIC
low complexity region	1404	1414	N/A	INTRINSIC
low complexity region	1464	1474	N/A	INTRINSIC
low complexity region	1616	1628	N/A	INTRINSIC

Meta Mutation Damage Score

0.0712

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Atg4c	G	A	4: 99,228,559	V313I	probably benign	Het
Ccdc18	A	G	5: 108,206,728	E1111G	possibly damaging	Het
Chuk	T	C	19: 44,081,957	H573R	probably benign	Het
Cst13	A	G	2: 148,828,174	N88S	probably benign	Het
Dalrd3	T	C	9: 108,570,077		probably null	Het
Dnah8	T	A	17: 30,794,763	M3826K	possibly damaging	Het
Dsp	A	G	13: 38,167,501		probably null	Het
Fbxo41	A	G	6: 85,475,094	L810P	probably damaging	Het
Fcrlb	T	C	1: 170,907,961	Y248C	probably damaging	Het
Gmcl1	A	G	6: 86,714,259		silent	Het
Gtf3c3	C	A	1: 54,419,437	A442S	probably benign	Het
Hdac4	T	C	1: 91,959,421	S799G	probably damaging	Het
Hnrnpa2b1	C	G	6: 51,466,609		probably benign	Het
Hnrnpab	T	C	11: 51,604,681	E177G	probably damaging	Het
Knl1	A	G	2: 119,070,403	I862V	probably benign	Het
Lonp2	T	A	8: 86,673,071		probably null	Het
Map3k19	G	T	1: 127,830,355	P363T	probably damaging	Het
Morn3	A	G	5: 123,041,115	Y91H	probably damaging	Het
Myom2	A	G	8: 15,108,478	D810G	probably benign	Het
Nans	A	G	4: 46,500,180	Y188C	probably damaging	Het
Ndufs1	A	T	1: 63,147,389	D1E	probably benign	Het
Nelfb	T	C	2: 25,209,993	N204S	probably damaging	Het
Noxo1	T	C	17: 24,698,542	S31P	probably damaging	Het
Olfr312	T	A	11: 58,831,556	M134K	probably damaging	Het
Olfr53	A	G	7: 140,652,578	M200V	probably benign	Het
Olfr914	T	C	9: 38,606,663	L66S	probably damaging	Het
Pkd1l2	T	G	8: 117,065,746	T436P	possibly damaging	Het
Pkhd1l1	A	G	15: 44,581,790	D3686G	probably damaging	Het
Ppp2r5b	A	G	19: 6,230,944	L285S	probably damaging	Het
Pzp	A	T	6: 128,506,869	V522D	probably benign	Het
Rpe65	A	G	3: 159,615,676	D375G	probably benign	Het
Sacs	C	T	14: 61,211,547	L3681F	probably damaging	Het
Sft2d1	C	T	17: 8,320,653	T96I	probably damaging	Het
Slc12a7	A	G	13: 73,793,940	N312D	probably benign	Het
Spaca6	A	T	17: 17,831,247	K82*	probably null	Het
Stk32c	A	G	7: 139,188,279		probably benign	Het
Tet2	T	A	3: 133,487,885	N263Y	probably damaging	Het
Uxs1	T	C	1: 43,780,073	N190S	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Rictor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rictor	APN	15	6786590	missense	probably damaging	0.99
IGL00785:Rictor	APN	15	6776950	missense	probably damaging	1.00
IGL00801:Rictor	APN	15	6794534	missense	probably damaging	1.00
IGL01072:Rictor	APN	15	6789562	missense	probably damaging	0.98
IGL01139:Rictor	APN	15	6778268	missense	probably damaging	1.00
IGL01303:Rictor	APN	15	6708638	missense	probably benign	0.10
IGL01307:Rictor	APN	15	6774604	splice site	probably null
IGL01767:Rictor	APN	15	6777384	missense	probably damaging	1.00
IGL01774:Rictor	APN	15	6769777	missense	probably damaging	1.00
IGL01800:Rictor	APN	15	6774701	missense	probably damaging	0.99
IGL02192:Rictor	APN	15	6786414	missense	probably benign	0.00
IGL02503:Rictor	APN	15	6786443	missense	probably benign	0.06
IGL02652:Rictor	APN	15	6776187	critical splice donor site	probably null
IGL02656:Rictor	APN	15	6776920	missense	probably damaging	0.98
IGL02752:Rictor	APN	15	6787371	missense	probably benign	0.02
IGL03000:Rictor	APN	15	6769240	splice site	probably benign
IGL03118:Rictor	APN	15	6759518	missense	possibly damaging	0.93
IGL03182:Rictor	APN	15	6789598	missense	probably benign	0.08
Tense	UTSW	15	6759496	missense	possibly damaging	0.94
Tonus	UTSW	15	6769334	critical splice donor site	probably null
Torrid	UTSW	15	6759572	missense	probably damaging	1.00
R0149:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0288:Rictor	UTSW	15	6786540	missense	probably benign	0.08
R0304:Rictor	UTSW	15	6786371	splice site	probably null
R0336:Rictor	UTSW	15	6776753	critical splice acceptor site	probably null
R0361:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0423:Rictor	UTSW	15	6773900	missense	possibly damaging	0.77
R0453:Rictor	UTSW	15	6708642	missense	probably benign	0.01
R0515:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R0630:Rictor	UTSW	15	6794492	missense	probably damaging	1.00
R0730:Rictor	UTSW	15	6773986	splice site	probably benign
R0744:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0836:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0881:Rictor	UTSW	15	6791670	missense	probably benign
R1114:Rictor	UTSW	15	6794005	nonsense	probably null
R1367:Rictor	UTSW	15	6790638	splice site	probably benign
R1655:Rictor	UTSW	15	6772212	missense	probably benign	0.00
R1678:Rictor	UTSW	15	6756471	missense	probably benign	0.07
R1679:Rictor	UTSW	15	6768090	missense	possibly damaging	0.92
R1754:Rictor	UTSW	15	6735368	missense	probably damaging	1.00
R1757:Rictor	UTSW	15	6773862	missense	possibly damaging	0.95
R1762:Rictor	UTSW	15	6756573	missense	probably benign	0.00
R1914:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1915:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1994:Rictor	UTSW	15	6776156	missense	probably benign	0.18
R2145:Rictor	UTSW	15	6765107	missense	probably damaging	1.00
R2182:Rictor	UTSW	15	6772204	missense	probably damaging	0.96
R2191:Rictor	UTSW	15	6759614	missense	probably benign	0.04
R2357:Rictor	UTSW	15	6783562	missense	probably damaging	0.99
R2914:Rictor	UTSW	15	6769995	critical splice donor site	probably null
R3082:Rictor	UTSW	15	6774857	missense	probably benign	0.15
R3885:Rictor	UTSW	15	6759610	missense	probably damaging	1.00
R3900:Rictor	UTSW	15	6789473	missense	probably benign	0.01
R4376:Rictor	UTSW	15	6786967	missense	probably benign	0.00
R4611:Rictor	UTSW	15	6787144	missense	possibly damaging	0.75
R4644:Rictor	UTSW	15	6777935	nonsense	probably null
R4718:Rictor	UTSW	15	6783160	missense	possibly damaging	0.81
R4822:Rictor	UTSW	15	6791680	missense	probably benign	0.01
R4980:Rictor	UTSW	15	6781660	missense	probably damaging	1.00
R5034:Rictor	UTSW	15	6768095	missense	probably damaging	0.98
R5179:Rictor	UTSW	15	6795940	missense	probably damaging	1.00
R5386:Rictor	UTSW	15	6789504	missense	probably benign	0.37
R5532:Rictor	UTSW	15	6789565	missense	probably damaging	1.00
R5549:Rictor	UTSW	15	6786910	missense	probably damaging	1.00
R5715:Rictor	UTSW	15	6750716	nonsense	probably null
R5733:Rictor	UTSW	15	6783104	missense	probably benign
R5822:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5848:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5849:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5850:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5855:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5856:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5936:Rictor	UTSW	15	6784161	missense	probably damaging	0.99
R6155:Rictor	UTSW	15	6793977	missense	probably benign	0.44
R6394:Rictor	UTSW	15	6769309	missense	possibly damaging	0.59
R6549:Rictor	UTSW	15	6796175	missense	probably damaging	1.00
R6611:Rictor	UTSW	15	6750659	missense	probably damaging	1.00
R6657:Rictor	UTSW	15	6759496	missense	possibly damaging	0.94
R6705:Rictor	UTSW	15	6794012	missense	probably benign	0.00
R6819:Rictor	UTSW	15	6796036	critical splice donor site	probably null
R6985:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R6989:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7016:Rictor	UTSW	15	6774880	critical splice donor site	probably null
R7030:Rictor	UTSW	15	6708453	critical splice donor site	probably null
R7066:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7067:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7216:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R7396:Rictor	UTSW	15	6786981	missense	not run
R7449:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7450:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7452:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7616:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7620:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7643:Rictor	UTSW	15	6769269	nonsense	probably null
R7699:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7700:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7749:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7750:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7751:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7753:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7841:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7894:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7897:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7898:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7937:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7944:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8062:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8063:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8094:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8119:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8134:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R8166:Rictor	UTSW	15	6769334	critical splice donor site	probably null
R8324:Rictor	UTSW	15	6745562	missense	probably damaging	1.00
R8343:Rictor	UTSW	15	6778319	critical splice donor site	probably null
R8691:Rictor	UTSW	15	6787032	missense	probably damaging	1.00
R8859:Rictor	UTSW	15	6783586	missense	probably damaging	0.98
R8953:Rictor	UTSW	15	6794447	missense	probably benign	0.39
R8977:Rictor	UTSW	15	6783085	missense	probably benign
R9008:Rictor	UTSW	15	6772129	splice site	probably benign
R9369:Rictor	UTSW	15	6744367	missense	probably benign	0.00
R9563:Rictor	UTSW	15	6768081	missense	possibly damaging	0.83
R9695:Rictor	UTSW	15	6786529	missense	probably benign	0.00
X0020:Rictor	UTSW	15	6756482	missense	probably benign	0.32
X0060:Rictor	UTSW	15	6786552	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTCATCCCTGGGCAATTCAG -3'
(R):5'- TCACTAATACCGACCTGCAGAG -3'

Sequencing Primer
(F):5'- GCAATTCAGGTTTCTTTGACAGTC -3'
(R):5'- TGCAGAGCCCGAGACAAC -3'

Posted On

2017-02-10