Incidental Mutation 'R5854:Spaca6'
ID454840
Institutional Source Beutler Lab
Gene Symbol Spaca6
Ensembl Gene ENSMUSG00000080316
Gene Namesperm acrosome associated 6
SynonymsB230206P06Rik, 4930546H06Rik, Ncrna00085
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17827158-17843009 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 17831247 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 82 (K82*)
Ref Sequence ENSEMBL: ENSMUSP00000128732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139969] [ENSMUST00000150302] [ENSMUST00000172097] [ENSMUST00000226899] [ENSMUST00000228490]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000012759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137228
Predicted Effect probably null
Transcript: ENSMUST00000139969
AA Change: K62*
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316
AA Change: K62*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155293
Predicted Effect probably null
Transcript: ENSMUST00000172097
AA Change: K82*
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316
AA Change: K82*

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196737
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Predicted Effect probably benign
Transcript: ENSMUST00000228490
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion that inactivates this gene exhibit impaired fertilization and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Spaca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Spaca6 APN 17 17831167 missense probably benign 0.41
IGL02630:Spaca6 APN 17 17831089 missense probably damaging 1.00
IGL03010:Spaca6 APN 17 17838405 missense probably benign 0.01
IGL03352:Spaca6 APN 17 17838139 missense probably damaging 1.00
R0021:Spaca6 UTSW 17 17838236 nonsense probably null
R0964:Spaca6 UTSW 17 17838391 missense possibly damaging 0.46
R1941:Spaca6 UTSW 17 17838402 missense probably benign 0.05
R1941:Spaca6 UTSW 17 17838430 missense probably damaging 0.99
R2197:Spaca6 UTSW 17 17836154 critical splice donor site probably null
R2235:Spaca6 UTSW 17 17838245 critical splice donor site probably null
R4602:Spaca6 UTSW 17 17831125 missense probably damaging 0.99
R4645:Spaca6 UTSW 17 17836045 intron probably benign
R4672:Spaca6 UTSW 17 17836743 nonsense probably null
R5044:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R5212:Spaca6 UTSW 17 17838394 missense probably benign 0.01
R5222:Spaca6 UTSW 17 17838105 missense probably benign 0.02
R5528:Spaca6 UTSW 17 17831082 missense probably benign
R6029:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R7041:Spaca6 UTSW 17 17836096 missense probably benign 0.14
R7268:Spaca6 UTSW 17 17832107 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TATCTTCTCCTCAGACCCGG -3'
(R):5'- GTCTCCACCCCACTCTGGA -3'

Sequencing Primer
(F):5'- ACCCGGAGACCCTCTGTTATG -3'
(R):5'- ACCCCACTCTGGACCTGTTTC -3'
Posted On2017-02-10