Incidental Mutation 'R0555:Elmod1'
ID 45485
Institutional Source Beutler Lab
Gene Symbol Elmod1
Ensembl Gene ENSMUSG00000041986
Gene Name ELMO/CED-12 domain containing 1
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0555 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 53911457-53975301 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 53931592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048409] [ENSMUST00000166580]
AlphaFold Q3V1U8
Predicted Effect probably benign
Transcript: ENSMUST00000048409
SMART Domains Protein: ENSMUSP00000046191
Gene: ENSMUSG00000041986

Pfam:ELMO_CED12 117 295 3.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166580
SMART Domains Protein: ENSMUSP00000129082
Gene: ENSMUSG00000041986

Pfam:ELMO_CED12 114 296 9.6e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216880
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele exhibit circling, absent startle reflex, deafness, organ of Corti degeneration and abnormal cochlear hair stereociliary bundle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Elmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Elmod1 APN 9 53924398 critical splice donor site probably null
IGL01803:Elmod1 APN 9 53931480 missense probably benign 0.01
IGL01966:Elmod1 APN 9 53921327 missense probably benign 0.00
IGL02354:Elmod1 APN 9 53931558 missense probably damaging 1.00
IGL02361:Elmod1 APN 9 53931558 missense probably damaging 1.00
IGL03107:Elmod1 APN 9 53934223 splice site probably benign
IGL03277:Elmod1 APN 9 53925988 missense probably damaging 1.00
R0013:Elmod1 UTSW 9 53912901 splice site probably benign
R0013:Elmod1 UTSW 9 53912901 splice site probably benign
R0243:Elmod1 UTSW 9 53935547 splice site probably benign
R0530:Elmod1 UTSW 9 53925976 missense probably damaging 0.96
R0592:Elmod1 UTSW 9 53926106 splice site probably benign
R0670:Elmod1 UTSW 9 53912822 missense probably damaging 0.96
R1054:Elmod1 UTSW 9 53912774 missense probably benign 0.02
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1875:Elmod1 UTSW 9 53935867 missense probably benign 0.00
R4445:Elmod1 UTSW 9 53934129 missense probably damaging 1.00
R4573:Elmod1 UTSW 9 53925972 missense probably damaging 1.00
R5895:Elmod1 UTSW 9 53935807 missense probably damaging 0.99
R6826:Elmod1 UTSW 9 53919599 missense probably benign 0.02
R7181:Elmod1 UTSW 9 53934098 splice site probably null
R7334:Elmod1 UTSW 9 53934224 splice site probably null
R7422:Elmod1 UTSW 9 53912843 missense probably damaging 0.99
R7964:Elmod1 UTSW 9 53931576 missense probably benign 0.00
R8511:Elmod1 UTSW 9 53912811 missense probably damaging 1.00
R9335:Elmod1 UTSW 9 53935832 missense probably benign 0.01
R9362:Elmod1 UTSW 9 53926020 missense possibly damaging 0.80
Z1088:Elmod1 UTSW 9 53919614 missense probably benign 0.00
Z1176:Elmod1 UTSW 9 53946860 missense probably benign 0.22
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcctagaatgcaacatgagatcc -3'
Posted On 2013-06-11