Incidental Mutation 'R5855:Cul1'
ID 454865
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Name cullin 1
Synonyms
MMRRC Submission 043229-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5855 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 47453398-47526139 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47523213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 653 (D653N)
Ref Sequence ENSEMBL: ENSMUSP00000122702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200]
AlphaFold Q9WTX6
Predicted Effect probably benign
Transcript: ENSMUST00000031697
AA Change: D653N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686
AA Change: D653N

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126877
Predicted Effect probably benign
Transcript: ENSMUST00000146200
AA Change: D653N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686
AA Change: D653N

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154201
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T G 7: 131,424,599 L57R probably damaging Het
Bmpr1b G A 3: 141,871,385 T55M possibly damaging Het
Cep350 G A 1: 155,953,762 T132I probably benign Het
Cops4 A T 5: 100,547,414 M400L probably benign Het
Cyp3a13 C G 5: 137,919,056 L36F probably damaging Het
Dcaf10 T C 4: 45,342,558 F131L probably benign Het
Dgkh T C 14: 78,624,504 probably null Het
Igll1 C T 16: 16,861,057 V130M probably damaging Het
Kif2c C T 4: 117,182,542 probably benign Het
Klra7 T C 6: 130,218,958 D262G possibly damaging Het
Lrrc27 T C 7: 139,218,335 probably benign Het
Maf A G 8: 115,705,792 S358P probably benign Het
Map1a A G 2: 121,303,674 D1419G possibly damaging Het
Map3k1 G A 13: 111,755,979 A914V probably benign Het
Naa25 T G 5: 121,423,692 L436R possibly damaging Het
Ndc1 T C 4: 107,383,707 I294T probably damaging Het
Nek1 A C 8: 61,016,272 D121A probably damaging Het
Nfil3 C T 13: 52,968,710 G53R probably benign Het
Olfr63 T C 17: 33,269,336 V204A possibly damaging Het
Parp14 A T 16: 35,840,927 Y1550* probably null Het
Patl1 A G 19: 11,921,516 I192V probably damaging Het
Pax3 G A 1: 78,121,651 T367I probably damaging Het
Pla2g4a C T 1: 149,880,063 V208M probably damaging Het
Prdm10 A T 9: 31,337,323 K347M probably damaging Het
Prkd1 A T 12: 50,392,916 M376K probably benign Het
Prkg1 C T 19: 30,894,694 V219I possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox4 T C 13: 28,952,996 E9G probably damaging Het
Spon1 T A 7: 114,029,072 D354E probably damaging Het
Stat2 T A 10: 128,283,494 L450H probably damaging Het
Tek T A 4: 94,853,553 M849K probably damaging Het
Tmem63c G A 12: 87,075,726 D433N probably damaging Het
Tnpo3 G A 6: 29,589,033 T106I probably damaging Het
Tns1 G T 1: 73,918,033 A1674D possibly damaging Het
Trim8 T C 19: 46,515,410 V467A possibly damaging Het
Trmo T A 4: 46,382,568 H183L probably benign Het
Trpm1 C A 7: 64,268,962 C683* probably null Het
Vsig10 T G 5: 117,338,270 L263R probably damaging Het
Zfp874a A T 13: 67,442,693 Y291N probably benign Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47509044 missense probably benign
IGL02410:Cul1 APN 6 47485014 missense probably damaging 1.00
IGL02458:Cul1 APN 6 47525608 missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47514886 missense probably damaging 0.98
IGL03065:Cul1 APN 6 47495081 missense probably damaging 1.00
IGL03387:Cul1 APN 6 47501209 missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47523205 missense probably benign 0.01
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0436:Cul1 UTSW 6 47523773 missense probably benign 0.16
R0746:Cul1 UTSW 6 47518288 splice site probably null
R1103:Cul1 UTSW 6 47517177 missense probably benign 0.03
R1471:Cul1 UTSW 6 47514886 missense probably damaging 0.98
R1746:Cul1 UTSW 6 47508245 missense probably damaging 0.98
R1852:Cul1 UTSW 6 47520830 missense probably damaging 0.99
R1858:Cul1 UTSW 6 47525524 splice site probably null
R1937:Cul1 UTSW 6 47508355 missense probably benign 0.19
R1964:Cul1 UTSW 6 47502571 missense probably damaging 0.98
R2985:Cul1 UTSW 6 47502507 missense probably damaging 1.00
R4452:Cul1 UTSW 6 47508989 nonsense probably null
R4653:Cul1 UTSW 6 47484963 missense probably damaging 1.00
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R5141:Cul1 UTSW 6 47520839 missense probably benign 0.04
R5328:Cul1 UTSW 6 47508317 missense probably damaging 0.99
R5399:Cul1 UTSW 6 47485084 splice site probably null
R5593:Cul1 UTSW 6 47485086 nonsense probably null
R5593:Cul1 UTSW 6 47514991 missense probably damaging 0.99
R5616:Cul1 UTSW 6 47523788 missense probably damaging 1.00
R6382:Cul1 UTSW 6 47502439 missense probably damaging 1.00
R6670:Cul1 UTSW 6 47517134 missense probably damaging 1.00
R6964:Cul1 UTSW 6 47516509 missense probably benign 0.01
R8146:Cul1 UTSW 6 47495093 missense possibly damaging 0.50
R8373:Cul1 UTSW 6 47515063 missense possibly damaging 0.78
R8842:Cul1 UTSW 6 47515076 missense probably damaging 1.00
R8899:Cul1 UTSW 6 47497312 missense possibly damaging 0.84
R9093:Cul1 UTSW 6 47518239 missense probably damaging 1.00
R9352:Cul1 UTSW 6 47502492 missense probably benign 0.00
RF001:Cul1 UTSW 6 47524581 missense possibly damaging 0.50
RF055:Cul1 UTSW 6 47517133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGACCATTTCTGTGAGGC -3'
(R):5'- CAGCATTAAAAGCAGAGTCCAG -3'

Sequencing Primer
(F):5'- AGGCACTGTAAAGAAGTATTCTTCC -3'
(R):5'- TTAAAAGCAGAGTCCAGTTCCCCTG -3'
Posted On 2017-02-10