Mutagenetix > Incidental Mutation

Incidental Mutation 'R5855:Trpm1'

454867

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

043229-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5855 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 64268962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 683 (C683*)

Ref Sequence

ENSEMBL: ENSMUSP00000145593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably null
Transcript: ENSMUST00000085222
AA Change: C1567*

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: C1567*

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000107519
AA Change: C1451*

SMART Domains

Protein: ENSMUSP00000103143
Gene: ENSMUSG00000030523
AA Change: C1451*

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
low complexity region	505	534	N/A	INTRINSIC
low complexity region	707	719	N/A	INTRINSIC
transmembrane domain	760	779	N/A	INTRINSIC
Pfam:Ion_trans	791	1004	1.3e-15	PFAM
transmembrane domain	1034	1051	N/A	INTRINSIC
low complexity region	1100	1109	N/A	INTRINSIC
PDB:3E7K\|H	1112	1163	1e-7	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000107525
AA Change: C1573*

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: C1573*

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000107527
AA Change: C683*

SMART Domains

Protein: ENSMUSP00000103151
Gene: ENSMUSG00000030523
AA Change: C683*

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	221	234	N/A	INTRINSIC
low complexity region	273	282	N/A	INTRINSIC
low complexity region	332	341	N/A	INTRINSIC
PDB:3E7K\|H	344	395	9e-8	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

probably null
Transcript: ENSMUST00000206263
AA Change: C1451*

Predicted Effect

probably null
Transcript: ENSMUST00000206277
AA Change: C1573*

Predicted Effect

probably null
Transcript: ENSMUST00000206314
AA Change: C683*

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 96.8%
20x: 89.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	T	G	7: 131,424,599	L57R	probably damaging	Het
Bmpr1b	G	A	3: 141,871,385	T55M	possibly damaging	Het
Cep350	G	A	1: 155,953,762	T132I	probably benign	Het
Cops4	A	T	5: 100,547,414	M400L	probably benign	Het
Cul1	G	A	6: 47,523,213	D653N	probably benign	Het
Cyp3a13	C	G	5: 137,919,056	L36F	probably damaging	Het
Dcaf10	T	C	4: 45,342,558	F131L	probably benign	Het
Dgkh	T	C	14: 78,624,504		probably null	Het
Igll1	C	T	16: 16,861,057	V130M	probably damaging	Het
Kif2c	C	T	4: 117,182,542		probably benign	Het
Klra7	T	C	6: 130,218,958	D262G	possibly damaging	Het
Lrrc27	T	C	7: 139,218,335		probably benign	Het
Maf	A	G	8: 115,705,792	S358P	probably benign	Het
Map1a	A	G	2: 121,303,674	D1419G	possibly damaging	Het
Map3k1	G	A	13: 111,755,979	A914V	probably benign	Het
Naa25	T	G	5: 121,423,692	L436R	possibly damaging	Het
Ndc1	T	C	4: 107,383,707	I294T	probably damaging	Het
Nek1	A	C	8: 61,016,272	D121A	probably damaging	Het
Nfil3	C	T	13: 52,968,710	G53R	probably benign	Het
Olfr63	T	C	17: 33,269,336	V204A	possibly damaging	Het
Parp14	A	T	16: 35,840,927	Y1550*	probably null	Het
Patl1	A	G	19: 11,921,516	I192V	probably damaging	Het
Pax3	G	A	1: 78,121,651	T367I	probably damaging	Het
Pla2g4a	C	T	1: 149,880,063	V208M	probably damaging	Het
Prdm10	A	T	9: 31,337,323	K347M	probably damaging	Het
Prkd1	A	T	12: 50,392,916	M376K	probably benign	Het
Prkg1	C	T	19: 30,894,694	V219I	possibly damaging	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Sox4	T	C	13: 28,952,996	E9G	probably damaging	Het
Spon1	T	A	7: 114,029,072	D354E	probably damaging	Het
Stat2	T	A	10: 128,283,494	L450H	probably damaging	Het
Tek	T	A	4: 94,853,553	M849K	probably damaging	Het
Tmem63c	G	A	12: 87,075,726	D433N	probably damaging	Het
Tnpo3	G	A	6: 29,589,033	T106I	probably damaging	Het
Tns1	G	T	1: 73,918,033	A1674D	possibly damaging	Het
Trim8	T	C	19: 46,515,410	V467A	possibly damaging	Het
Trmo	T	A	4: 46,382,568	H183L	probably benign	Het
Vsig10	T	G	5: 117,338,270	L263R	probably damaging	Het
Zfp874a	A	T	13: 67,442,693	Y291N	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACATCCCATACATCGTGTCCG -3'
(R):5'- TTGGATGGTCAAGATGGCAGC -3'

Sequencing Primer
(F):5'- GAAGCAGCCTCGCAAGACG -3'
(R):5'- CCATCGATGGTCTGGCTG -3'

Posted On

2017-02-10