Incidental Mutation 'R5855:Spon1'
ID 454868
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
MMRRC Submission 043229-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R5855 (G1)
Quality Score 149
Status Not validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 114029072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 354 (D354E)
Ref Sequence ENSEMBL: ENSMUSP00000041157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687]
AlphaFold Q8VCC9
Predicted Effect probably damaging
Transcript: ENSMUST00000046687
AA Change: D354E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: D354E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T G 7: 131,424,599 L57R probably damaging Het
Bmpr1b G A 3: 141,871,385 T55M possibly damaging Het
Cep350 G A 1: 155,953,762 T132I probably benign Het
Cops4 A T 5: 100,547,414 M400L probably benign Het
Cul1 G A 6: 47,523,213 D653N probably benign Het
Cyp3a13 C G 5: 137,919,056 L36F probably damaging Het
Dcaf10 T C 4: 45,342,558 F131L probably benign Het
Dgkh T C 14: 78,624,504 probably null Het
Igll1 C T 16: 16,861,057 V130M probably damaging Het
Kif2c C T 4: 117,182,542 probably benign Het
Klra7 T C 6: 130,218,958 D262G possibly damaging Het
Lrrc27 T C 7: 139,218,335 probably benign Het
Maf A G 8: 115,705,792 S358P probably benign Het
Map1a A G 2: 121,303,674 D1419G possibly damaging Het
Map3k1 G A 13: 111,755,979 A914V probably benign Het
Naa25 T G 5: 121,423,692 L436R possibly damaging Het
Ndc1 T C 4: 107,383,707 I294T probably damaging Het
Nek1 A C 8: 61,016,272 D121A probably damaging Het
Nfil3 C T 13: 52,968,710 G53R probably benign Het
Olfr63 T C 17: 33,269,336 V204A possibly damaging Het
Parp14 A T 16: 35,840,927 Y1550* probably null Het
Patl1 A G 19: 11,921,516 I192V probably damaging Het
Pax3 G A 1: 78,121,651 T367I probably damaging Het
Pla2g4a C T 1: 149,880,063 V208M probably damaging Het
Prdm10 A T 9: 31,337,323 K347M probably damaging Het
Prkd1 A T 12: 50,392,916 M376K probably benign Het
Prkg1 C T 19: 30,894,694 V219I possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox4 T C 13: 28,952,996 E9G probably damaging Het
Stat2 T A 10: 128,283,494 L450H probably damaging Het
Tek T A 4: 94,853,553 M849K probably damaging Het
Tmem63c G A 12: 87,075,726 D433N probably damaging Het
Tnpo3 G A 6: 29,589,033 T106I probably damaging Het
Tns1 G T 1: 73,918,033 A1674D possibly damaging Het
Trim8 T C 19: 46,515,410 V467A possibly damaging Het
Trmo T A 4: 46,382,568 H183L probably benign Het
Trpm1 C A 7: 64,268,962 C683* probably null Het
Vsig10 T G 5: 117,338,270 L263R probably damaging Het
Zfp874a A T 13: 67,442,693 Y291N probably benign Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8064:Spon1 UTSW 7 114036621 missense probably damaging 1.00
R8075:Spon1 UTSW 7 114016793 critical splice donor site probably null
R8927:Spon1 UTSW 7 114030357 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
R9278:Spon1 UTSW 7 114028953 missense probably damaging 1.00
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTACAGCCCTTCCCAAATG -3'
(R):5'- AGCTTCAGTACCAACTATGCAC -3'

Sequencing Primer
(F):5'- TGGTTTCTAGGAGAGCAGCACC -3'
(R):5'- CTATGCACCCTACTAGACAAGG -3'
Posted On 2017-02-10