Mutagenetix > Incidental Mutations

Incidental Mutation 'R5855:Nek1'

454871

Institutional Source

Beutler Lab

Gene Symbol

Nek1

Ensembl Gene

ENSMUSG00000031644

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 1

Synonyms

kidney, anemia and testis, kat, D8Ertd790e

MMRRC Submission

043229-MU

Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5855 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60993195-61131346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 61016272 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 121 (D121A)

Ref Sequence

ENSEMBL: ENSMUSP00000147258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034065
AA Change: D121A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: D121A

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	556	592	N/A	INTRINSIC
coiled coil region	647	685	N/A	INTRINSIC
low complexity region	767	780	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120689
AA Change: D121A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: D121A

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	487	510	N/A	INTRINSIC
low complexity region	521	533	N/A	INTRINSIC
coiled coil region	584	620	N/A	INTRINSIC
coiled coil region	675	713	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC
low complexity region	1158	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155664

Predicted Effect

probably damaging
Transcript: ENSMUST00000211256
AA Change: D121A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211672
AA Change: D121A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 96.8%
20x: 89.3%

Validation Efficiency

MGI Phenotype

Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	T	G	7: 131,424,599	L57R	probably damaging	Het
Bmpr1b	G	A	3: 141,871,385	T55M	possibly damaging	Het
Cep350	G	A	1: 155,953,762	T132I	probably benign	Het
Cops4	A	T	5: 100,547,414	M400L	probably benign	Het
Cul1	G	A	6: 47,523,213	D653N	probably benign	Het
Cyp3a13	C	G	5: 137,919,056	L36F	probably damaging	Het
Dcaf10	T	C	4: 45,342,558	F131L	probably benign	Het
Dgkh	T	C	14: 78,624,504		probably null	Het
Igll1	C	T	16: 16,861,057	V130M	probably damaging	Het
Kif2c	C	T	4: 117,182,542		probably benign	Het
Klra7	T	C	6: 130,218,958	D262G	possibly damaging	Het
Lrrc27	T	C	7: 139,218,335		probably benign	Het
Maf	A	G	8: 115,705,792	S358P	probably benign	Het
Map1a	A	G	2: 121,303,674	D1419G	possibly damaging	Het
Map3k1	G	A	13: 111,755,979	A914V	probably benign	Het
Naa25	T	G	5: 121,423,692	L436R	possibly damaging	Het
Ndc1	T	C	4: 107,383,707	I294T	probably damaging	Het
Nfil3	C	T	13: 52,968,710	G53R	probably benign	Het
Olfr63	T	C	17: 33,269,336	V204A	possibly damaging	Het
Parp14	A	T	16: 35,840,927	Y1550*	probably null	Het
Patl1	A	G	19: 11,921,516	I192V	probably damaging	Het
Pax3	G	A	1: 78,121,651	T367I	probably damaging	Het
Pla2g4a	C	T	1: 149,880,063	V208M	probably damaging	Het
Prdm10	A	T	9: 31,337,323	K347M	probably damaging	Het
Prkd1	A	T	12: 50,392,916	M376K	probably benign	Het
Prkg1	C	T	19: 30,894,694	V219I	possibly damaging	Het
Rictor	G	A	15: 6,794,006	E1555K	probably benign	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Sox4	T	C	13: 28,952,996	E9G	probably damaging	Het
Spon1	T	A	7: 114,029,072	D354E	probably damaging	Het
Stat2	T	A	10: 128,283,494	L450H	probably damaging	Het
Tek	T	A	4: 94,853,553	M849K	probably damaging	Het
Tmem63c	G	A	12: 87,075,726	D433N	probably damaging	Het
Tnpo3	G	A	6: 29,589,033	T106I	probably damaging	Het
Tns1	G	T	1: 73,918,033	A1674D	possibly damaging	Het
Trim8	T	C	19: 46,515,410	V467A	possibly damaging	Het
Trmo	T	A	4: 46,382,568	H183L	probably benign	Het
Trpm1	C	A	7: 64,268,962	C683*	probably null	Het
Vsig10	T	G	5: 117,338,270	L263R	probably damaging	Het
Zfp874a	A	T	13: 67,442,693	Y291N	probably benign	Het

Other mutations in Nek1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Nek1	APN	8	61043284	missense	probably benign	0.00
IGL01075:Nek1	APN	8	61124132	missense	possibly damaging	0.64
IGL01122:Nek1	APN	8	61120966	missense	possibly damaging	0.80
IGL01151:Nek1	APN	8	61020077	missense	probably damaging	1.00
IGL01286:Nek1	APN	8	61124216	missense	possibly damaging	0.64
IGL01377:Nek1	APN	8	61089456	missense	probably benign
IGL01485:Nek1	APN	8	61049826	missense	probably benign	0.02
IGL01688:Nek1	APN	8	61105597	nonsense	probably null
IGL01806:Nek1	APN	8	61124212	missense	possibly damaging	0.82
IGL02006:Nek1	APN	8	61104192	missense	probably benign	0.20
IGL02304:Nek1	APN	8	61012167	missense	probably damaging	1.00
IGL02659:Nek1	APN	8	61089480	missense	probably benign	0.16
IGL02662:Nek1	APN	8	61104184	missense	probably benign	0.00
IGL02801:Nek1	APN	8	61121061	critical splice donor site	probably null
IGL02806:Nek1	APN	8	61044086	missense	probably benign	0.15
IGL03037:Nek1	APN	8	61034052	missense	probably benign	0.16
IGL03252:Nek1	APN	8	61072330	nonsense	probably null
P0014:Nek1	UTSW	8	61071747	splice site	probably benign
R0019:Nek1	UTSW	8	61089734	missense	probably benign	0.01
R0403:Nek1	UTSW	8	61106855	missense	probably damaging	0.99
R0464:Nek1	UTSW	8	61072273	splice site	probably benign
R0726:Nek1	UTSW	8	61089592	missense	probably damaging	1.00
R0761:Nek1	UTSW	8	61089455	missense	probably benign
R0827:Nek1	UTSW	8	61105648	splice site	probably benign
R0972:Nek1	UTSW	8	61089431	splice site	probably null
R1268:Nek1	UTSW	8	61022264	missense	probably damaging	1.00
R1343:Nek1	UTSW	8	61028675	missense	probably damaging	1.00
R1415:Nek1	UTSW	8	61089686	missense	probably benign	0.00
R1466:Nek1	UTSW	8	61125136	splice site	probably benign
R1480:Nek1	UTSW	8	61124326	splice site	probably null
R1526:Nek1	UTSW	8	61049941	missense	probably benign	0.26
R1552:Nek1	UTSW	8	61006737	missense	probably damaging	0.99
R1606:Nek1	UTSW	8	61124276	missense	possibly damaging	0.82
R1650:Nek1	UTSW	8	61036076	missense	probably benign	0.00
R1757:Nek1	UTSW	8	61089813	splice site	probably null
R1808:Nek1	UTSW	8	61016230	missense	probably damaging	1.00
R1966:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R2067:Nek1	UTSW	8	61007162	missense	probably damaging	1.00
R2111:Nek1	UTSW	8	61124326	splice site	probably null
R2113:Nek1	UTSW	8	61016293	missense	probably damaging	1.00
R2143:Nek1	UTSW	8	61028696	missense	probably damaging	1.00
R2255:Nek1	UTSW	8	61089773	missense	probably damaging	1.00
R2422:Nek1	UTSW	8	61019901	missense	probably damaging	1.00
R3848:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3849:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3850:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R4418:Nek1	UTSW	8	61106864	missense	probably damaging	1.00
R4526:Nek1	UTSW	8	61106944	missense	probably damaging	0.99
R4533:Nek1	UTSW	8	61007213	missense	possibly damaging	0.95
R4544:Nek1	UTSW	8	61016304	nonsense	probably null
R4677:Nek1	UTSW	8	61028806	missense	probably damaging	0.99
R4739:Nek1	UTSW	8	61098511	missense	probably benign	0.32
R5068:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R5421:Nek1	UTSW	8	61006677	missense	possibly damaging	0.81
R5516:Nek1	UTSW	8	61089489	missense	probably benign	0.03
R6125:Nek1	UTSW	8	61028701	missense	probably damaging	1.00
R6267:Nek1	UTSW	8	61072309	nonsense	probably null
R6292:Nek1	UTSW	8	61054736	intron	probably null
R6296:Nek1	UTSW	8	61072309	nonsense	probably null
R6458:Nek1	UTSW	8	61100012	missense	probably benign	0.00
R6568:Nek1	UTSW	8	61106821	missense	probably benign	0.00
R6629:Nek1	UTSW	8	61054333	intron	probably null
R6867:Nek1	UTSW	8	61072330	missense	possibly damaging	0.81
R7122:Nek1	UTSW	8	61106795	missense	probably benign	0.00
R7193:Nek1	UTSW	8	61073578	missense	probably damaging	0.99
R7272:Nek1	UTSW	8	61125086	missense	probably benign	0.34
R7356:Nek1	UTSW	8	61120960	missense	probably benign	0.02
R7368:Nek1	UTSW	8	61089707	missense	probably benign	0.24
R7478:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7479:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7512:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7715:Nek1	UTSW	8	61006760	missense	probably damaging	0.98
X0028:Nek1	UTSW	8	61043258	missense	probably benign	0.19
X0066:Nek1	UTSW	8	61125128	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AATTACTTGGTCTGAAGAGTGAGG -3'
(R):5'- TCGGGTATCTGAGTGAGCAG -3'

Sequencing Primer
(F):5'- GCCCAACAAACTTATCTGCCTATTAC -3'
(R):5'- TATCTGAGTGAGCAGGACAGCC -3'

Posted On

2017-02-10