Incidental Mutation 'R5855:Zfp874a'
ID454880
Institutional Source Beutler Lab
Gene Symbol Zfp874a
Ensembl Gene ENSMUSG00000069206
Gene Namezinc finger protein 874a
SynonymsZfp874, Rslcan15, C330011K17Rik
MMRRC Submission 043229-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5855 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67424549-67451624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67442693 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 291 (Y291N)
Ref Sequence ENSEMBL: ENSMUSP00000074735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057241] [ENSMUST00000075255] [ENSMUST00000180580] [ENSMUST00000223682] [ENSMUST00000225479]
Predicted Effect probably benign
Transcript: ENSMUST00000057241
SMART Domains Protein: ENSMUSP00000077307
Gene: ENSMUSG00000069206

DomainStartEndE-ValueType
KRAB 5 65 1.73e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075255
AA Change: Y291N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074735
Gene: ENSMUSG00000069206
AA Change: Y291N

DomainStartEndE-ValueType
KRAB 5 65 1.73e-27 SMART
ZnF_C2H2 137 159 9.58e-3 SMART
ZnF_C2H2 165 187 5.99e-4 SMART
ZnF_C2H2 193 215 7.26e-3 SMART
ZnF_C2H2 221 243 2.4e-3 SMART
ZnF_C2H2 249 269 1.88e2 SMART
ZnF_C2H2 277 299 5.21e-4 SMART
ZnF_C2H2 305 327 2.12e-4 SMART
ZnF_C2H2 333 355 2.12e-4 SMART
ZnF_C2H2 361 383 8.47e-4 SMART
ZnF_C2H2 389 411 1.79e-2 SMART
ZnF_C2H2 417 438 2.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180580
SMART Domains Protein: ENSMUSP00000137953
Gene: ENSMUSG00000069206

DomainStartEndE-ValueType
KRAB 5 65 1.73e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224239
Predicted Effect probably benign
Transcript: ENSMUST00000225479
Predicted Effect probably benign
Transcript: ENSMUST00000225778
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T G 7: 131,424,599 L57R probably damaging Het
Bmpr1b G A 3: 141,871,385 T55M possibly damaging Het
Cep350 G A 1: 155,953,762 T132I probably benign Het
Cops4 A T 5: 100,547,414 M400L probably benign Het
Cul1 G A 6: 47,523,213 D653N probably benign Het
Cyp3a13 C G 5: 137,919,056 L36F probably damaging Het
Dcaf10 T C 4: 45,342,558 F131L probably benign Het
Dgkh T C 14: 78,624,504 probably null Het
Igll1 C T 16: 16,861,057 V130M probably damaging Het
Kif2c C T 4: 117,182,542 probably benign Het
Klra7 T C 6: 130,218,958 D262G possibly damaging Het
Lrrc27 T C 7: 139,218,335 probably benign Het
Maf A G 8: 115,705,792 S358P probably benign Het
Map1a A G 2: 121,303,674 D1419G possibly damaging Het
Map3k1 G A 13: 111,755,979 A914V probably benign Het
Naa25 T G 5: 121,423,692 L436R possibly damaging Het
Ndc1 T C 4: 107,383,707 I294T probably damaging Het
Nek1 A C 8: 61,016,272 D121A probably damaging Het
Nfil3 C T 13: 52,968,710 G53R probably benign Het
Olfr63 T C 17: 33,269,336 V204A possibly damaging Het
Parp14 A T 16: 35,840,927 Y1550* probably null Het
Patl1 A G 19: 11,921,516 I192V probably damaging Het
Pax3 G A 1: 78,121,651 T367I probably damaging Het
Pla2g4a C T 1: 149,880,063 V208M probably damaging Het
Prdm10 A T 9: 31,337,323 K347M probably damaging Het
Prkd1 A T 12: 50,392,916 M376K probably benign Het
Prkg1 C T 19: 30,894,694 V219I possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox4 T C 13: 28,952,996 E9G probably damaging Het
Spon1 T A 7: 114,029,072 D354E probably damaging Het
Stat2 T A 10: 128,283,494 L450H probably damaging Het
Tek T A 4: 94,853,553 M849K probably damaging Het
Tmem63c G A 12: 87,075,726 D433N probably damaging Het
Tnpo3 G A 6: 29,589,033 T106I probably damaging Het
Tns1 G T 1: 73,918,033 A1674D possibly damaging Het
Trim8 T C 19: 46,515,410 V467A possibly damaging Het
Trmo T A 4: 46,382,568 H183L probably benign Het
Trpm1 C A 7: 64,268,962 C683* probably null Het
Vsig10 T G 5: 117,338,270 L263R probably damaging Het
Other mutations in Zfp874a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02490:Zfp874a APN 13 67442700 nonsense probably null
R1052:Zfp874a UTSW 13 67442420 missense possibly damaging 0.89
R1991:Zfp874a UTSW 13 67442504 missense probably benign 0.03
R2085:Zfp874a UTSW 13 67442848 missense probably damaging 1.00
R2103:Zfp874a UTSW 13 67442504 missense probably benign 0.03
R5129:Zfp874a UTSW 13 67442981 missense probably damaging 1.00
R5336:Zfp874a UTSW 13 67442680 missense probably damaging 1.00
R5423:Zfp874a UTSW 13 67442354 missense possibly damaging 0.75
R5713:Zfp874a UTSW 13 67449357 missense probably benign 0.16
R6496:Zfp874a UTSW 13 67442575 missense possibly damaging 0.62
R7046:Zfp874a UTSW 13 67442299 missense probably damaging 1.00
R7065:Zfp874a UTSW 13 67442282 missense probably damaging 0.97
R7233:Zfp874a UTSW 13 67442657 missense possibly damaging 0.83
R7271:Zfp874a UTSW 13 67443296 missense probably benign 0.00
R7465:Zfp874a UTSW 13 67442257 missense probably damaging 0.99
R7468:Zfp874a UTSW 13 67425604 utr 3 prime probably null
X0063:Zfp874a UTSW 13 67442987 missense probably damaging 1.00
Z1177:Zfp874a UTSW 13 67442662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGATTTGATGTCTTTTCAGGGAT -3'
(R):5'- CTCTTAGTAGTCGCTCATCACTT -3'

Sequencing Primer
(F):5'- GCATTCTACACACTCATGGGG -3'
(R):5'- GAGTGTGACAAAGCCTTTCTTC -3'
Posted On2017-02-10