Mutagenetix > Incidental Mutations

Incidental Mutation 'R5855:Rictor'

454883

Institutional Source

Beutler Lab

Gene Symbol

Rictor

Ensembl Gene

ENSMUSG00000050310

Gene Name

RPTOR independent companion of MTOR, complex 2

Synonyms

D530039E11Rik, 4921505C17Rik, 6030405M08Rik

MMRRC Submission

043229-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5855 (G1)

Quality Score

199

Status

Not validated

Chromosome

Chromosomal Location

6708379-6800401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 6794006 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1555 (E1555K)

Ref Sequence

ENSEMBL: ENSMUSP00000051809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061656]

Predicted Effect

probably benign
Transcript: ENSMUST00000061656
AA Change: E1555K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: E1555K

Domain	Start	End	E-Value	Type
RICTOR_N	57	439	4.02e-185	SMART
RICTOR_M	523	742	5.66e-98	SMART
RasGEF_N_2	743	857	1.26e-54	SMART
RICTOR_V	920	992	1.44e-40	SMART
low complexity region	1019	1043	N/A	INTRINSIC
RICTOR_phospho	1084	1189	4.06e-58	SMART
low complexity region	1221	1239	N/A	INTRINSIC
low complexity region	1255	1266	N/A	INTRINSIC
low complexity region	1273	1287	N/A	INTRINSIC
low complexity region	1404	1414	N/A	INTRINSIC
low complexity region	1464	1474	N/A	INTRINSIC
low complexity region	1616	1628	N/A	INTRINSIC

Meta Mutation Damage Score

0.104

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 96.8%
20x: 89.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	T	G	7: 131,424,599	L57R	probably damaging	Het
Bmpr1b	G	A	3: 141,871,385	T55M	possibly damaging	Het
Cep350	G	A	1: 155,953,762	T132I	probably benign	Het
Cops4	A	T	5: 100,547,414	M400L	probably benign	Het
Cul1	G	A	6: 47,523,213	D653N	probably benign	Het
Cyp3a13	C	G	5: 137,919,056	L36F	probably damaging	Het
Dcaf10	T	C	4: 45,342,558	F131L	probably benign	Het
Dgkh	T	C	14: 78,624,504		probably null	Het
Igll1	C	T	16: 16,861,057	V130M	probably damaging	Het
Kif2c	C	T	4: 117,182,542		probably benign	Het
Klra7	T	C	6: 130,218,958	D262G	possibly damaging	Het
Lrrc27	T	C	7: 139,218,335		probably benign	Het
Maf	A	G	8: 115,705,792	S358P	probably benign	Het
Map1a	A	G	2: 121,303,674	D1419G	possibly damaging	Het
Map3k1	G	A	13: 111,755,979	A914V	probably benign	Het
Naa25	T	G	5: 121,423,692	L436R	possibly damaging	Het
Ndc1	T	C	4: 107,383,707	I294T	probably damaging	Het
Nek1	A	C	8: 61,016,272	D121A	probably damaging	Het
Nfil3	C	T	13: 52,968,710	G53R	probably benign	Het
Olfr63	T	C	17: 33,269,336	V204A	possibly damaging	Het
Parp14	A	T	16: 35,840,927	Y1550*	probably null	Het
Patl1	A	G	19: 11,921,516	I192V	probably damaging	Het
Pax3	G	A	1: 78,121,651	T367I	probably damaging	Het
Pla2g4a	C	T	1: 149,880,063	V208M	probably damaging	Het
Prdm10	A	T	9: 31,337,323	K347M	probably damaging	Het
Prkd1	A	T	12: 50,392,916	M376K	probably benign	Het
Prkg1	C	T	19: 30,894,694	V219I	possibly damaging	Het
Scn3a	T	C	2: 65,464,730	I1550V	possibly damaging	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Sox4	T	C	13: 28,952,996	E9G	probably damaging	Het
Spon1	T	A	7: 114,029,072	D354E	probably damaging	Het
Stat2	T	A	10: 128,283,494	L450H	probably damaging	Het
Tek	T	A	4: 94,853,553	M849K	probably damaging	Het
Tmem63c	G	A	12: 87,075,726	D433N	probably damaging	Het
Tnpo3	G	A	6: 29,589,033	T106I	probably damaging	Het
Tns1	G	T	1: 73,918,033	A1674D	possibly damaging	Het
Trim8	T	C	19: 46,515,410	V467A	possibly damaging	Het
Trmo	T	A	4: 46,382,568	H183L	probably benign	Het
Trpm1	C	A	7: 64,268,962	C683*	probably null	Het
Vsig10	T	G	5: 117,338,270	L263R	probably damaging	Het
Zfp874a	A	T	13: 67,442,693	Y291N	probably benign	Het

Other mutations in Rictor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rictor	APN	15	6786590	missense	probably damaging	0.99
IGL00785:Rictor	APN	15	6776950	missense	probably damaging	1.00
IGL00801:Rictor	APN	15	6794534	missense	probably damaging	1.00
IGL01072:Rictor	APN	15	6789562	missense	probably damaging	0.98
IGL01139:Rictor	APN	15	6778268	missense	probably damaging	1.00
IGL01303:Rictor	APN	15	6708638	missense	probably benign	0.10
IGL01307:Rictor	APN	15	6774604	splice site	probably null
IGL01767:Rictor	APN	15	6777384	missense	probably damaging	1.00
IGL01774:Rictor	APN	15	6769777	missense	probably damaging	1.00
IGL01800:Rictor	APN	15	6774701	missense	probably damaging	0.99
IGL02192:Rictor	APN	15	6786414	missense	probably benign	0.00
IGL02503:Rictor	APN	15	6786443	missense	probably benign	0.06
IGL02652:Rictor	APN	15	6776187	critical splice donor site	probably null
IGL02656:Rictor	APN	15	6776920	missense	probably damaging	0.98
IGL02752:Rictor	APN	15	6787371	missense	probably benign	0.02
IGL03000:Rictor	APN	15	6769240	splice site	probably benign
IGL03118:Rictor	APN	15	6759518	missense	possibly damaging	0.93
IGL03182:Rictor	APN	15	6789598	missense	probably benign	0.08
R0149:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0288:Rictor	UTSW	15	6786540	missense	probably benign	0.08
R0304:Rictor	UTSW	15	6786371	splice site	probably null
R0336:Rictor	UTSW	15	6776753	critical splice acceptor site	probably null
R0361:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0423:Rictor	UTSW	15	6773900	missense	possibly damaging	0.77
R0453:Rictor	UTSW	15	6708642	missense	probably benign	0.01
R0515:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R0630:Rictor	UTSW	15	6794492	missense	probably damaging	1.00
R0730:Rictor	UTSW	15	6773986	splice site	probably benign
R0744:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0836:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0881:Rictor	UTSW	15	6791670	missense	probably benign
R1114:Rictor	UTSW	15	6794005	nonsense	probably null
R1367:Rictor	UTSW	15	6790638	splice site	probably benign
R1655:Rictor	UTSW	15	6772212	missense	probably benign	0.00
R1678:Rictor	UTSW	15	6756471	missense	probably benign	0.07
R1679:Rictor	UTSW	15	6768090	missense	possibly damaging	0.92
R1754:Rictor	UTSW	15	6735368	missense	probably damaging	1.00
R1757:Rictor	UTSW	15	6773862	missense	possibly damaging	0.95
R1762:Rictor	UTSW	15	6756573	missense	probably benign	0.00
R1914:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1915:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1994:Rictor	UTSW	15	6776156	missense	probably benign	0.18
R2145:Rictor	UTSW	15	6765107	missense	probably damaging	1.00
R2182:Rictor	UTSW	15	6772204	missense	probably damaging	0.96
R2191:Rictor	UTSW	15	6759614	missense	probably benign	0.04
R2357:Rictor	UTSW	15	6783562	missense	probably damaging	0.99
R2914:Rictor	UTSW	15	6769995	critical splice donor site	probably null
R3082:Rictor	UTSW	15	6774857	missense	probably benign	0.15
R3885:Rictor	UTSW	15	6759610	missense	probably damaging	1.00
R3900:Rictor	UTSW	15	6789473	missense	probably benign	0.01
R4376:Rictor	UTSW	15	6786967	missense	probably benign	0.00
R4611:Rictor	UTSW	15	6787144	missense	possibly damaging	0.75
R4644:Rictor	UTSW	15	6777935	nonsense	probably null
R4718:Rictor	UTSW	15	6783160	missense	possibly damaging	0.81
R4822:Rictor	UTSW	15	6791680	missense	probably benign	0.01
R4980:Rictor	UTSW	15	6781660	missense	probably damaging	1.00
R5034:Rictor	UTSW	15	6768095	missense	probably damaging	0.98
R5179:Rictor	UTSW	15	6795940	missense	probably damaging	1.00
R5386:Rictor	UTSW	15	6789504	missense	probably benign	0.37
R5532:Rictor	UTSW	15	6789565	missense	probably damaging	1.00
R5549:Rictor	UTSW	15	6786910	missense	probably damaging	1.00
R5715:Rictor	UTSW	15	6750716	nonsense	probably null
R5733:Rictor	UTSW	15	6783104	missense	probably benign
R5822:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5848:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5849:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5850:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5854:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5856:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5936:Rictor	UTSW	15	6784161	missense	probably damaging	0.99
R6155:Rictor	UTSW	15	6793977	missense	probably benign	0.44
R6394:Rictor	UTSW	15	6769309	missense	possibly damaging	0.59
R6549:Rictor	UTSW	15	6796175	missense	probably damaging	1.00
R6611:Rictor	UTSW	15	6750659	missense	probably damaging	1.00
R6657:Rictor	UTSW	15	6759496	missense	possibly damaging	0.94
R6705:Rictor	UTSW	15	6794012	missense	probably benign	0.00
R6819:Rictor	UTSW	15	6796036	critical splice donor site	probably null
R6985:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R6989:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7016:Rictor	UTSW	15	6774880	critical splice donor site	probably null
R7030:Rictor	UTSW	15	6708453	critical splice donor site	probably null
R7066:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7067:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7216:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R7396:Rictor	UTSW	15	6786981	missense	not run
R7449:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7450:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7452:Rictor	UTSW	15	6772154	missense	probably benign	0.27
X0020:Rictor	UTSW	15	6756482	missense	probably benign	0.32
X0060:Rictor	UTSW	15	6786552	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTCATCCCTGGGCAATTCAG -3'
(R):5'- TCACTAATACCGACCTGCAGAG -3'

Sequencing Primer
(F):5'- GCAATTCAGGTTTCTTTGACAGTC -3'
(R):5'- TGCAGAGCCCGAGACAAC -3'

Posted On

2017-02-10